Please Rate My Answer...... Thank......u...
please draw out picture for the experiment * NOW design an experiment to determine whether your...
1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It is 249 bp long, and is suspected to be a serine protease inhibitor ATGAGCAGCGGCGGCCTGCTGCTGCTGCTGGGCCTGCTGACCTTTTGCGCGGAACTGACC CCGGTGAGCAGCCGCAAACGCCATCCGTATTGCAACCTGCCGCCGGATCCGGGCCCGTGC CATGATAACAAATTTGCGTTTTATCATCATCCGGCGAGCAACAAATGCAAAGAATTTGTG TATGGCGGCTGCGGCGGCAACGATAACCGCTTTAAAACCCGCAACAAATGCCAGTGCACC TGCAGCGGC a) Which sequencing method would you use to sequence a gene in this size range, and why? (Name of technique and 1-2 sentence explanation.) b) What technique would you use to amplify the DNA, in order to make more of it for future experiments? (What is...
PLEASE ANSWER QUESTIONS 8-10
PLEASE
ANSWER # 8-10!!!!
Your goal for this experiment is to design a synthesis for: o- Experiment Questions How do I design a multi-step syntheses given starting material and product? • How can I synthesize trans-1,2-cyclohexanediol from hexanol using reactions already learned in lecture and lab? Experiment Techniques · Using distillation as a separation technique. • Using washing (a type of extraction) for purification Introduction So far this semester, you have performed three different types of...
1. According to the paper, what does lactate dehydrogenase
(LDH) do and what does it allow to happen within the myofiber? (5
points)
2. According to the paper, what is the major disadvantage of
relying on glycolysis during high-intensity exercise? (5
points)
3. Using Figure 1 in the paper, briefly describe the different
sources of ATP production at 50% versus 90% AND explain whether you
believe this depiction of ATP production applies to a Type IIX
myofiber in a human....
Risk management in Information Security today Everyday information security professionals are bombarded with marketing messages around risk and threat management, fostering an environment in which objectives seem clear: manage risk, manage threat, stop attacks, identify attackers. These objectives aren't wrong, but they are fundamentally misleading.In this session we'll examine the state of the information security industry in order to understand how the current climate fails to address the true needs of the business. We'll use those lessons as a foundation...
10. Write a one-page summary of the attached paper? INTRODUCTION Many problems can develop in activated sludge operation that adversely affect effluent quality with origins in the engineering, hydraulic and microbiological components of the process. The real "heart" of the activated sludge system is the development and maintenance of a mixed microbial culture (activated sludge) that treats wastewater and which can be managed. One definition of a wastewater treatment plant operator is a "bug farmer", one who controls the aeration...