Question

1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It is 249 bp long, and is suspected to be a serine protease inhibitor ATGAGCAGCGGCGGCCTGCTGCTGCTGCTGGGCCTGCTGACCTTTTGCGCGGAACTGACC CCGGTGAGCAGCCGCAAACGCCATCCGTATTGCAACCTGCCGCCGGATCCGGGCCCGTGC CATGATAACAAATTTGCGTTTTATCATCATCCGGCGAGCAACAAATGCAAAGAATTTGTG TATGGCGGCTGCGGCGGCAACGATAACCGCTTTAAAACCCGCAACAAATGCCAGTGCACC TGCAGCGGC a) Which sequencing method would you use to sequence a gene in this size range, and why? (Name of technique and 1-2 sentence explanation.) b) What technique would you use to amplify the DNA, in order to make more of it for future experiments? (What is the method called?) c) Design primers for amplification of this gene, indicating clearly the 5 and 3' ends. Your primers should have a Tm of 55 3°C. Calculate and list the T for each primer, including the equation for their calculation d) What technique will you use to separate the DNA and determine if it is the right size? (What is the method called?)

Answer 1

Sanger sequencing can be used for DNA in range size 200 to 1000 bp long- as it has higher sensiturty to detect low frequency variants b. We can amplify DNA using PCR. ie Polymeran chain reaction involving steps - dinaturation, annealing and Extension " 5' ATGAGCAGC GG - CAGCG G C 3 GT C G C C G & premer premer , 3' si pre SATGAGC 31 TACT CGT d. Gel electrophoresis can be und for separating DNA fragments as it is based on size and charge of macromobaule e By dye called Ethidium bromide we c Visualine d. We can use BLAST which is a ST which is multiple sequena alignment comparison

Laddu 500 350 250 249. 350 bp will show result (postul control) 299 bp will not give result (regative ) contid