Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence using PCR. Note: Both strands shown below. 5'-CCACTAGGGAGCTACGTAGGCACGGCATTACACGGATAGGCATTAACG-3' 3'-GGTGATCCCTCGATGCATCCGTGCCGTAATGTGCCTATCCGTAATTGC-5'
The correct primer here is 5' CCACTAG3' 5'CGTTAAT3' since it is complementary to DNA at the two 3' ends of either strands of DNA.
Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence...
Pick a pair of primers that you could use to amplify the following double-stranded DNA sequence using PCR. Note: Both strands shown below. 5'-GGTGATCGGAGCTACGTAGGCACGGCATTACACGGATAGGCTAATTGC-3' 3'-CCACTAGCCTCGATGCATCCGTGCCGTAATGTGCCTATCCGATTAACG-5' 5'-CCACTAG-3' ; 5'-GCAATTA-3' 5'-GATCACC-3' ; 5'-CGTTAAT-3' 5'-GGTGATC-3' ; 5'-GCAATTA-3' 5'-CCACTAG-3' ; 5'-CGTTAAT-3' 5'-GGTGATC-3' ; 5'-CGTTAAT-3'
Below is a sequence of double-stranded DNA that will be used as a template in the polymerase chain reaction (PCR). The goal is to use this as a template to make a a PCR product that includes the shaded area. The sequence of one of the PCR primers is given below. Template DNA: 5' - CTTAGCGCTGTTGGGGGCCAACTATCACACACACCACACACAGGTATAAATGGCATTTGATACAGATTG - 3' 3' - GAATCTGTATCAAATGCCATTTATACCTGTGTGTGGTGTGTGTGATAGTTGGCCCCCAACAGCGCTAAG - 5' If the sequence of one of the primers is 5' TTGTGGGGCC 3' which of the following primers...
You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to amplify all of the red (ds) sequence, and only the red sequence? Primers should be 8 nts long (note: usually 17-25 nts long) Hint: Think about direction of DNA synthesis and annealing of primer to double-stranded template ! To answer, write the primer sequence (8 nts each) into the provided space below with the indicated 5' 3' polarity. 5'---AATGCCGTCAGCCGATCTGCCTCGAGTCAATC GATGCTGGTAACTTGGGGTATAAAGCTTACCCATGG TATCGTAGTTAGATTGATTGTTAGGTTCTTAGGTTTA GGTTTCTGGTATTGGTTTAGGGTCTTTGATGCTATTA ATTGTTTGGTTTTGATTTGGTCTTTATATGGTTTATG TTTTAAGCCGGGTTTTGTCTGGGATGGTTCGTCTGAT...
You want to use PCR to amplify the entire DNA shown in the figure below. Of the listed primers, choose the pair that will allow you to amplify this stretch of DNA by PCR. (9 points total) DNA to be amplified 5’-CGATTCGAGCCATTCGAACTCGATCAGCCGATTCGATCAACCTTGGACAGTCAG-3’ 3’-GCTAAGCTCGGTAAGCTTGAGCTAGTCGGCTAAGCTAGTTGGAACCTGTCAGTC-5’ Primers: (1) 5’-GCTAAGCTCGGTA-3’ (5) 5’-CTTGGACAGTCAG-3’ (2) 5’-GAACCTGTCAGTC-3’ (6) 5’-CGATTCGAGCCAT-3’ (3) 5’-CTGACTGTCCAAG-3’ (7) 5’-ATGGCTCGAATCG-3’ (4) 5’-GACTGACAGGTTC-3’ (8) 5’-TACCGAGCTTAGC-3’ Answer: I will need primer number _____ and primer number _____
The following is the DNA sequence of the wild type allele of genr Z that you want to amplify using the polymerase chain reaction (PCR). Circle the set(s) of primers from the options below, which you would use for PCR reaction. Circle all that apply. 10. The following is the DNA sequence of the wild type allele of Gene Z that you want to amplify using the polymerase chain reaction (PCR). 5' CTCGAGGTGAATATGAAAG---- 3'GAGCTCCACTTATACTTTC---- Gene Z ---CATTTGGCGCGTAATCGATA3 ---GTAAACCGCGCATTAGCTATS! Circle the...
1) You want to amplify the DNA between the two stretches of sequence shown below. What are the sequences of primers you would use to amplify this DNA? How many different combinations of primers can you use? DNA to be amplified 5'-GACCTGTGGAAGC- 3'-CTGGACACCTTCG CATACGGGATTGA-3 -GTATGCCCTAACT-5'
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...
Which of the following components is NOT used in the technique of PCR to amplify a specific DNA sequence in a mouse genome? O Specific single-stranded DNA primers O Double-stranded genomic mouse DNA O Heat-stable DNA polymerase D DNA ligase
You want to amplify the DNA between the two stretches of sequence shown below. Of the listed primer pairs, choose the correct pair that will allow you to amplify the DNA by PCR. 5'-ACATTACCAA----GACCTGCTTT-3' 3' -TGTAATGGTT----CTGGACGAAA-5' 5' -TGTAATGGTT-3' and 5'-TTTCGTCCAG-3' O 5'-ACATTACCAA-3' and 5'-AAAGCAGGTC-3' 5'-TGTAATGGTT-3' and 5'-CTGGACGAAA-3' O 5'-AACCATTACA-3' and 5'-CTGGACGAAA-3'
You want to amplify the DNA between the two stretches of sequence shown below. Of the listed primer pairs, choose the correct pair that will allow you to amplify the DNA by PCR. 5’-CTGGACGAAA----TGTAATGGTT-3’ 3’-GACCTGCTTT----ACATTACCAA-5’ A. 5’-CTGGACGAAA-3’ and 5’-TGTAATGGTT-3’ B. 5’-CTGGACGAAA-3’ and 5’-AACCATTACA-3’ C. 5’-TTTCGTCCAG-3’ and 5’-TGTAATGGTT-3’ D. 5’-GACCTGCTTT-3’ and 5’-ACATTACCAA-3’