Please do like the answer
Cyclic RGD peptide (below) is used to noninvasively image carcinomas that overexpress integrin avß3 receptors. 3)...
3. The questions below refer to the cyclic peptide shown below. HO H. -ΝΗ HN OH HN -NH ot SH Me a. This peptide is made from how many amino acids? (single number on the line) b. How many potential diastereomers are possible for this molecule? (single number) c. Starting at the glycine residue, draw the linear, Fmoc-protected form of the peptide shown above. Make sure you are drawing the correct stereochemistry! Do not use any abbreviations. Draw out the...
organic chemistry
3. The starting material below forms a six-membered cyclic hemiacetal in an aqueous solution: (pis) r , " a) Name the starting material b) Draw the mechanism of the reaction above. Note the role of H". c) How many stereoisomers are possible for the starting material? d) How many stereoisomers are possible for the cyclic hemiacetal? 4. Propose a mechanism for the formation of the cyclic acetal by treating acetone with ethylene glycol in the presence of an...
please answer
5. Secondary structure (B-sheet): The image below is of a polypeptide in secondary (2) structure level of protein folding. Specifically it is of a B-sheet. The image on the left is of an anti-parallel sheet, and the right of a parallel sheet. a. Name the specific bond/interaction indicated by the dotted lines. b. Is this bond/interaction covalent or non-covalent? c. Is this bond/interaction permanent or transient? d. What parts of the amino acid (backbone or side chain) are...
3. Cyclic compounds The presence of the ring in all but very large ring cyclic molecules prevents full rotation of the ring atoms. For this reason, stereoisomerism may also occur in cyclic molecules. a) Prepare a model of cyclohexane, C6H12. Draw the condensed formula. b) Build a model of methylcyclohexane (C7H14) by replacing one of the hydrogens of cyclohexane with a methyl group. Draw the skeletal formula for methylcyclohexane. 2 c) How many different isomers exist for methylcyclohexane (CyH34)? d)...
Augu Q46. Below is a DNA sequence from a yeast GPCR gene. Using RNA sequencing methods you have obtained the following partial 5' sequence for the MRNA transcribed from this gene: 5'-GGUCCAU... 5'GTATAAGAAGCACTCTACCTCAATGGGTCCATGGGAGAAGGTAGGCATGTGTATTTGACAAAGGGA i. What are the most likely six N-terminal amino acids for the above gene? (2 pts) Examine the other reading frames. Explain why you can exclude those other possible reading frames from consideration (one or two reasons depending upon the frame). (2 pts) Circle the portion of...
1. A chemical reaction "A" has a DG of -10 kcal/mole. Calculate the key for the reaction A. Show the equation that you have used and all the calculations to get full credit. (2 pts). 2. State two common features among most of the activate carriers that you have studied in class. (2 points) 3. Study the sequence of the peptide given below and answer the following questions based on the peptide sequence given below. AGLRHTICHMKDCFY (10 points) A. Name...
38,39
38. Which of the lanes in the gel below would represent an "uninduced" sample? M, 1 23 456 78 A) 1 B) C)3 D) 4 E) 5 2 39. lodoacetamides, maleimides, benzyl halides, and bromomethyl ketones can all be used to modify the residues group on A) amino; basic B) phenyl; Tyr and Trp C) carboxyl; acidic D) sulfhydryl; Cys E) hydroxyl; Ser and Tyr 40. Which statement about intrinsically disordered proteins is TRUE? A) B) C) They contain...
Question 5. Which of the following pairs of bonds within a peptide backbone show free rotation around both bonds? A) Ca-C and N-C B) C-O and N-C C) C-O and N-Ca D) N-C and Ca-C E) N-Ca and N-C Question 6. In the diagram below, the plane drawn behind the peptide bond indicates the: A) absence of rotation around the C-N bond because of its partial double-bond character. B) plane of rotation around the C-N bond. region of steric hindrance...
1. In biology, the term "ionic bond" is used differently than in chemistry. A biological "ionic bond" is used to describe the interaction of an R group containing a carboxyl group (–COO–) with an R group containing an amino group (–NH3+). From this description, what do you understand a biological "ionic bond" to be? a. van der waals interaction b. hydrogen bond c. Electrostatic interaction d. covalent bond 2. The three dimensional arrangement of alpha helices, beta-sheets and other parts...
C. Review of Lipids 6. Draw the complete reaction for the hydrogenation and saponification of the triacylglycerol below. Make sure you the reaction is balanced. HC I Hydrogenation reaction using 2 moles of H (9) banoro Saponification reaction os c) a cyclic secondary alcohol biolo wolvo Mode ostin obrolan insand word do Ya d) a tertiary amine that contains no more than 4 carbons. (0) Holmsgniew more nownegosby e) the aromatic isomers of an aromatic ring that contains one hydroxyl...