Homework Answers
Add Answer to:
Question 8 4 pts After a single base pair change, the following amino acid sequence was...
Shown below are the amino acid sequences of the wild-type and three mutant forms of a...
Shown below are the amino acid sequences of the wild-type and three mutant forms of a short protein. Each mutation results from a single nucleotide change (transition/transversion / insertion / deletion). Use this information to answer the following questions. Hint: First, reconstruct as much as you can of the wild-type RNA sequence and then reference that sequence when analyzing the mutations. Wild type: met - gin-ala - ser-val - arg - phe Mutant 1: met - gln - pro-ser -...
Shown below are the amino acid sequences of the wild-type and three mutant forms of a...
Shown below are the amino acid sequences of the wild-type and three mutant forms of a short protein. Each mutation results from a single nucleotide change (transition / transversion / insertion / deletion). Use this information to answer the following questions. Hint: First, reconstruct as much as you can of the wild-type RNA sequence and then reference that sequence when analyzing the mutations. Wild type: met – gln – ala – ser – val – arg – phe Mutant 1:...
This sequence is RNA because:
20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...
3. A small peptide has the amino acid sequence Phe-Leu-Tyr-Ala-Leu-Gly-Glu. A shorter variant of this peptide...
3. A small peptide has the amino acid sequence Phe-Leu-Tyr-Ala-Leu-Gly-Glu. A shorter variant of this peptide was discovered that had the sequence Phe-Leu-Tyr-Ala; it was demonstrated that this shorter peptide was due to a single base substitution in the second Leu codon. What type of mutation (missense, nonsense, frameshift) gave rise to this shorter peptide? Which of the six possible Leu codons was used in the synthesis of the original (long) peptide (can you eliminate some as possibilities)?
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Use the Mutations interactive to determine which statements describe silent mutations. The adenine of the start...
Use the Mutations interactive
to determine which statements describe silent mutations. The
adenine of the start codon is position +1.
a substitution from G to T in the arginine codon of the
antisense stand
a substitution of a G nucleotide at position +9 in the antisense
strand
a transition at position +6 in the sense strand
a transversion of A in the histidine codon of the antisense
strand
a single nucleotide deletion at position +12 in the antisense
strand
a...
multiple choice question Consider the DNA coding (non-template) strand: 5-AAG TAC-3 What would be the amino...
multiple choice question Consider the DNA coding (non-template) strand: 5-AAG TAC-3 What would be the amino acid sequence (using the three-letter abbreviations) for the resulting dipeptide? Becond GU الا لا 16 First Base BE LE ACC Third Base > COCO لا لا لا | GCA GCG GAG- GGG - Lys-Tyr Phệ-Met His-Glu Lys-Tyr 8 Phe-Met His-Glu Met-His + Change seat Send a message to the instructor < Join another session
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
Shown below are the amino acid sequences of the wild-type and three mutant forms of a short protein. Each mutation results from a single nucleotide change (transition/transversion / insertion / deletion). Use this information to answer the following questions. Hint: First, reconstruct as much as you can of the wild-type RNA sequence and then reference that sequence when analyzing the mutations. Wild type: met - gin-ala - ser-val - arg - phe Mutant 1: met - gln - pro-ser -...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Use the Mutations interactive
to determine which statements describe silent mutations. The
adenine of the start codon is position +1.
a substitution from G to T in the arginine codon of the
antisense stand
a substitution of a G nucleotide at position +9 in the antisense
strand
a transition at position +6 in the sense strand
a transversion of A in the histidine codon of the antisense
strand
a single nucleotide deletion at position +12 in the antisense
strand
a...
multiple choice question Consider the DNA coding (non-template) strand: 5-AAG TAC-3 What would be the amino acid sequence (using the three-letter abbreviations) for the resulting dipeptide? Becond GU الا لا 16 First Base BE LE ACC Third Base > COCO لا لا لا | GCA GCG GAG- GGG - Lys-Tyr Phệ-Met His-Glu Lys-Tyr 8 Phe-Met His-Glu Met-His + Change seat Send a message to the instructor < Join another session
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
Most questions answered within 3 hours.
-
The manager at a car assembly plant believes that the mean
assembly time for a car...
asked 34 minutes ago -
Which of the following is true of electron capture?
A) It decreases the nuclide's mass number...
asked 2 hours ago -
Assuming an efficiency of 43.10%, calculate the actual yield of
magnesium nitrate formed from 114.9 g...
asked 2 hours ago -
The highly pathogenic bacterium Clostridium
perfringens causes gangrene, a disease that results in the
destruction of...
asked 4 hours ago -
In the context of situation analysis, which of the following is
a category for analysis in...
asked 4 hours ago -
In a study of the gas phase decomposition of sulfuryl chloride
at 600 K SO2Cl2(g)SO2(g) +...
asked 4 hours ago -
75 g of 2-propanol (C3H8O) and 25 g of pentane are mixed in a
200 mL...
asked 4 hours ago -
The 2800-turn coil in a dc motor has an area per turn of 1.1 ×
10-2...
asked 4 hours ago -
Draw a combinational logic circuit diagram with a symbol inside
the box for two I/P of...
asked 4 hours ago -
The cliché we use quite a lot in finance is: there is a need to
maximize...
asked 4 hours ago -
In class we discussed the addition of HCl to alpha pinene. Would
you expect one or...
asked 4 hours ago -
I'm trying to explain to my daughter to help her please help
me
I tagged the...
asked 4 hours ago