10.) The mRNA transcribed from the DNA is encoded in 5'-3' direction by RNA polymerase. Right after it is called primary transcript and it contains long stretch of introns which are basically junk part of mRNA. After post transcriptional modifications it goes to the cytoplasm where mRNA is translated into amino acids.
5'- AUG GGG CCC UUU AAA UGA -3' (mRNA sequence)
N- Met Gly Pro Phe Lys Stop- C (Amino acid sequence)
N-terminus- Methionine- Glycine- Proline- Phenylalanine- Lysine- Stop codon- C terminus |
These amino acid chains are joined together with peptide bonds which makes the primary structure of proteins. Further after folding of the primary structure of proteins, they makes the secondary, tertiary structure of different proteins.
9. Transcribe the top strand of this DNA into RNA. Label the 3' and 5' ends....
number 8 & 10 please 8. What are the garden Hotels nu Wu WUJUNW e the E, P, and A sites? What happens at each? 9. Transcribe the top strand of this DNA into RNA. Label the 3' and 5' ends. DNA: 3TAC CCC GGG AAA TTT ACT 5 → Top strand 15 3'er hos' So RNA will be 5 ATG GGG CCC TTT AAA TGA 3 (5'AUG GGG CCC UUU AAA UGA 3 10. Now translate your mRNA into...
Transcribe the DNA sequence into the mRNA sequence and label its 5' and 3' ends. 3 - TAC AAA GAG GAT CCG ACC TCA ACT - 5 What is the full name (extended version, like discussed in the lecture) of the enzyme that performs this process?
Using the table: A peptide has the sequence NH2-phe-pro-lys-gly-phe-pro-COOH. What is the sequence in DNA that codes for this peptide? a. 3' UUU-CCC-AAA-GGG-UUU-CCC b. 3' AAA-GGG-TTT-CCC-AAA-GGG c. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG d. 5' ACT-TAC-CAT-AAA-CAT-TAC-UGA e. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG Could you please explain also how you got the answer?
Type of DNA/RNA mutation: Type of protein mutation: 2. TTT 5' ATG 3" TAC GAG cтa GCT cGA CTT GAA GAA cтт AAA AAA ттт TAA ATT 3' 5 The corresponding mRNA would then be: And the protein that would be formed would be: Type of DNA/RNA mutation: Type of protein mutation:
Given the information coding of DNA strand: 5'-TTT-TAC-GAA-GAG-TGA-3', Write the corresponding DNA template and mRNA strand DNA template: 3' ------ 5' ______________ ______________ _____________ ____________ ____________ mRNA Strand: 5'------3' _____________ _____________ ____________ ____________ ______________
is this transcribe correctly ? please explain DNA Template Strand Sequence: TAA ACT CGG TAC ATT CTG GCT TAG CAC TAATTA CCC ATC Complementary mRNA Sequence: AUU AGA GCC AUG UAA GAC AUC GUG AUU AAU GGG UAG
Transcribe each of the following DNA sequences. Label the TEMPLATE DNA strand The arrow shows the direction of transcription. Draw the corresponding RNA molecule and label the 5' and 3' ends
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...
Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into its corresponding protein (USING SINGLE LETTER ABBREVIATIONS of the amino acids), and 3) determine the protein sequence if you had a DELETION mutation of the emboldened thymine. 3’ 5’ TCGGCGTGTACTACTACACGGTATATACGTTTCTTTTGATTAGCCGCTT