Homework Answers
1) template strand is :
3 ' GTTAAATTTTAAACGCGCGCGCGTTTTTT 5'
RNA molecule :5' AAAAUUUGCGCGCGCGCAAAAAA 3'
2) Template strand is :
3' TACGTACGTACGTACGTACGTACGTACGT 5'
RNA molecule : 5 ' CAUGCAUGCAUGCAUGCAUGCAUGCA 3'
Add Answer to:
Transcribe each of the following DNA sequences. Label the TEMPLATE DNA strand The arrow shows the...
Below is the template half of a segment of DNA. Transcribe this DNA and label the...
Below is the template half of a segment of DNA. Transcribe this DNA and label the ends. DNA: 3’-T A C C C T C A G T C A T G G A C A-5’ RNA:
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand....
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank
1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA,...
1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?
2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate...
2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3' 3' CGCTACTTTGCGGGCTGCATCCCG 5'
9. Transcribe the top strand of this DNA into RNA. Label the 3' and 5' ends....
9. Transcribe the top strand of this DNA into RNA. Label the 3' and 5' ends. DNA: 3' TAC CCC GGG AAA TTT ACT 5' 5' ATG GGG CCC TTT AAA TGA 3' S'AnGGGG CCc nUM AAA UGA? 10. Now translate your mRNA into Protein. Label the C-term and N-term.
Name: Section Transcription Worksheet (5 Points) Instructions: Below is the same DNA molecule from above. Now,...
Name: Section Transcription Worksheet (5 Points) Instructions: Below is the same DNA molecule from above. Now, it is preparing Renes in this region. Using pencil draw in and label the following items according cule from above. Now, it is preparing for transcription of the and label the following items according to the instructions. 1) Label template and non-template strands 2) Label 5' and 3' ends of template and non-template strand 3) Draw in and label RNA polymerase 4) Label transcription...
The following is a fragment of double stranded DNA . The bottom strand is the template...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT |...
11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT | CAA | AAAS , a. Write the corresponding mRNA section. Show the nucleic acid sequence as triplets and label the 5' and the 3' ends. b. Write the anticodons corresponding to the codons on the mRNA c. Write the three-letter and one-letter amino-acid sequence that will be placed in a peptide chain.
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank
1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?
2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3' 3' CGCTACTTTGCGGGCTGCATCCCG 5'
9. Transcribe the top strand of this DNA into RNA. Label the 3' and 5' ends. DNA: 3' TAC CCC GGG AAA TTT ACT 5' 5' ATG GGG CCC TTT AAA TGA 3' S'AnGGGG CCc nUM AAA UGA? 10. Now translate your mRNA into Protein. Label the C-term and N-term.
Name: Section Transcription Worksheet (5 Points) Instructions: Below is the same DNA molecule from above. Now, it is preparing Renes in this region. Using pencil draw in and label the following items according cule from above. Now, it is preparing for transcription of the and label the following items according to the instructions. 1) Label template and non-template strands 2) Label 5' and 3' ends of template and non-template strand 3) Draw in and label RNA polymerase 4) Label transcription...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT | CAA | AAAS , a. Write the corresponding mRNA section. Show the nucleic acid sequence as triplets and label the 5' and the 3' ends. b. Write the anticodons corresponding to the codons on the mRNA c. Write the three-letter and one-letter amino-acid sequence that will be placed in a peptide chain.
Most questions answered within 3 hours.
-
Romeo wishes to throw a bouquet of flowers to Juliet, who is on
a second-story balcony,...
asked 6 minutes ago -
Why is QE a controversial monetary policy tool.
A. It may lead to excessive inflation.B. By...
asked 23 minutes ago -
A finite potential well has depth U0 = 2.78 eV . What is the
penetration distance...
asked 48 minutes ago -
1. The bus bars of a power station are in two sections A and B
separated...
asked 47 minutes ago -
Fiscal policy is the deliberate manipulation of taxes and
government spending to alter GDP, employment, inflation...
asked 1 hour ago -
evaluating an expression using only one digit and + and - as
operators ....3+5-1+7-5+8
-----------------------
stack...
asked 1 hour ago -
Two concentric current loops lie in the same plane. The smaller
loop has a radius of...
asked 2 hours ago -
1)Which of the following is an
important difference between qualified and nonqualified retirement
plans?
a. Qualified...
asked 2 hours ago -
What's the streaming business's problem on the
horizon?
asked 3 hours ago -
I need help with writing the conclusion for this online lab
report
Abstract
By testing the...
asked 3 hours ago -
For the reaction 1N2+3H2-----> 2NH3, would the reaction rate
trend be: delta[NH3]/ delta t = -2...
asked 4 hours ago -
Within your current/past organization, identify a problem/issue
and format a design to address same. You may...
asked 3 hours ago