Below is the template half of a segment of DNA. Transcribe this DNA and label the ends. DNA: 3’-T A C C C T C A G T C A T G G A C A-5’ RNA:
5' AUGGGAGUCAGUACCUGU 3'
This with the corresponding mRNA sequence for the given DNA sequence. First the sequence has to be complemented and directed towards 5' to 3'. And then replacing all T with U.
Below is the template half of a segment of DNA. Transcribe this DNA and label the...
Transcribe each of the following DNA sequences. Label the TEMPLATE DNA strand The arrow shows the direction of transcription. Draw the corresponding RNA molecule and label the 5' and 3' ends
9. Transcribe the top strand of this DNA into RNA. Label the 3' and 5' ends. DNA: 3' TAC CCC GGG AAA TTT ACT 5' 5' ATG GGG CCC TTT AAA TGA 3' S'AnGGGG CCc nUM AAA UGA? 10. Now translate your mRNA into Protein. Label the C-term and N-term.
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts) ATTGCCAGATCATCCCAATAGAT Label the 5’ and 3’ ends of the DNA template. (1 pt) b) Give the sequence and label the 5’ and 3’ ends of the RNA transcribed from this template. (2 pts)
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
What is the primer in DNA replication? The first segment of template DNA that binds to primase. The primer is the dNTP that starts the reaction dNTP + DNAn → DNAn+1 + pyrophosphate. A short segment of RNA to which the growing DNA chain is bonded. A short sequence of DNA to which the growing DNA chain is bonded.
6) The following sequence of nucleotides is found in a single-stranded DNA template: ATT GCC AGA TCA TCC CAA TAG AT Assume that RNA polymerase proceeds along this template from left to right. a) Which end of the DNA template is the 5' end and which end is 3'? b) What is the sequence of the complimentary DNA strand? c) Give the sequence and label the 5' and 3' ends of the mRNA copied from this template.
QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...
Use the DNA sequence below and the genetic code in your text to answer the following questions. Template DNA 3ʹ T A A G C G A T A C G A G A 5ʹ Non-template DNA 5ʹ A T T C G C T A T G C T C T 3ʹ What is the RNA sequence that would be transcribed from the sequence above? Include the 3ʹ and 5ʹ ends. (0.5) b) What is the amino acid sequence...