What is the primer in DNA replication?
The first segment of template DNA that binds to primase.
The primer is the dNTP that starts the reaction dNTP + DNAn → DNAn+1 + pyrophosphate.
A short segment of RNA to which the growing DNA chain is bonded.
A short sequence of DNA to which the growing DNA chain is bonded.
As the DNA synthesis cannot start Denovo (on its own) we need a primer. The primer in DNA replication is a:
Short segment of RNA to which the growing DNA chain is bonded
What is the primer in DNA replication? The first segment of template DNA that binds to...
What bond holds together the RNA primer and DNA template during replication
Question 10 A human chromosome has 3 origins of replication. Assuming that all 3 origins of replication are used at the same time, what is the maximum number of helicases present on DNA during DNA replication (not including DNA repair)? 12 O 3 O2 Question 11 Which of the following correctly compares primase and telomerase? O Both primase and telomerase synthesize DNA using a DNA template. O Primase synthesizes RNA using an RNA template, but telomerase synthesizes DNA using a...
Vocabulary: DNA Replication A. Helicase B. Primase C. Single Strand Binding Protein (SSB) D. Topoisomerase E. Origin of Replication F. DNA Polymerase G. Leading Strand H. Lagging strand I. DNA Ligase J. Okazaki Fragment K. Replication Fork L. RNA Primer M. Topoisomerase .1. Site where the replication of a DNA molecule begins. 2. The new continuous complementary DNA strand synthesized in the direction for the replication fork. 3. A discontinuously synthesized DNA strand that elongates in a direction away from the replication fork 4. Relaxes...
where DnaG(primase) bind and make primer on the template DNA? usually the length of the okazaki fragment is around 1000-2000bp. how primase make primase on every 1000-2000bp. also, as primer is a kind of RNA polymerase, is there any specificity for binding on DNA? if so, how the length of the okazaki fragment could be relatively constant? how primase make *primase-> how primase make *primer
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...
3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector. 5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’ 3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’ To which DNA strand does the primer bind, the top or bottom one? Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band)...
Compared to RNA elongation by RNA polymerases, DNA elongation by DNA polymerase requires an additional reaction component. Which is appropriate for fulfillment of this requirement? Select one: a. a primase is needed for the biological DNA replication. b. a short DNA primer is necessary for PCR. c. a host tRNA is used for the synthesis of DNA by viral reverse transcriptase. d. All of these e. None of these
1. During DNA replication the lagging strand is complemented with Okazaki fragments that still contain the RNA primer. Which pair of enzymes removes the RNA primer and seals the DNA nicks? DNA polymerase I and ligase the DNA polymerases II and III primase and gyrase DNA polymerase III and helicase DNA polymerase III and primase 2. Which of the following best describes the process of DNA replication in a prokaryote? Replication begins at multiple sites, spreading outward until the entire...
25. Which is not a required reactant for a PCR reaction? Select one: a. Primer DNA b. Taq polymerase c. dNTP d. template DNA e. ATP