TRUE or FALSE: There is a linear relationship between genome size and open reading frame (ORF)...
TRUE or FALSE: There is a linear relationship between genome size and open reading frame (ORF) content in Eukaryotic species.
Homework Answers
It is false. There relationship between the genome size and the oen reading frame content , that is the nuber of protein coding genes is not linear. There is no fixed relationship between the genome size and the ORF content of organisms. Organisms with a smaller genome size might have larger number of protein coding genes and can be less complex than the organisms with larger genome size. For example the rice plant has a smaller genome than humans , however the number of ORFs is almost double that of humans.
Add Answer to:
TRUE or FALSE: There is a linear relationship
between genome size and open reading frame (ORF)...
This DNA sequence represents an open reading frame (ORF) of a transcriptional unit. Transcribe and then...
This DNA sequence represents an open reading frame (ORF) of a transcriptional unit. Transcribe and then translate this gene in the spaces provided below. 5' ATGGGAGCTGTTGTATTTGA 3' 3' TACCCTCGAGCAACATAAACT 5' Transcribe mRNA sequence and translated protein sequence.
Bioinformatics. Using the NCBI ORF Finder Web form, determine the open reading frames for the entire...
Bioinformatics. Using the NCBI ORF Finder Web form, determine the open reading frames for the entire DNA record for accession number EF595246 (coding region plus flank). Based on what you see, how many ORFs do you see? describe your choice of the correct reading frame and why you made that choice. Discuss your other strong choice.
The genome of a newly discovered bacterial species (Bacillus sanfranciscus) is sequenced and found to have...
The genome of a newly discovered bacterial species (Bacillus sanfranciscus) is sequenced and found to have a circular genome of 8.7 x106base pairs (bp). Open reading frame (ORF) analysis indicated the presence of 7,250 ORFs that encode proteins with an average length of 360 aa. What is the information content of this genome (i.e.– how much information can be encoded in this length of DNA)? Since the genetic code can be considered digital in nature, convert the information content of base pairs...
The genome of a newly discovered bacterial species (Bacillus sanfranciscus) is sequenced and found to have...
The genome of a newly discovered bacterial species (Bacillus sanfranciscus) is sequenced and found to have a circular genome of 8.7 x 106 base pairs (bp). Open reading frame (ORF) analysis indicated the presence of 7,250 ORFs that encode proteins with an average length of 360 aa. a. What is the information content of this genome (i.e. – how much information can be encoded in this length of DNA)?Since the genetic code can be considered digital in nature, convert the...
True or False 1. There is a positive relationship between changes in the yield to maturity...
True or False 1. There is a positive relationship between changes in the yield to maturity and changes in the value of previously issued bonds. 2. There is a positive relationship between changes in the coupon rate and changes in duration. 3. Duration is the weighted average time to maturity of a financial security. 4. There is a linear relationship between changes in the yield to maturity and changes in the value of a bond.
8. Degrees of freedom for chi-squared tests are determined by sample size. True or False 7....
8. Degrees of freedom for chi-squared tests are determined by sample size. True or False 7. If a correlation between two variables is negative, that means there is no linear relationship between them. True or False 2. For a chi-square test, if the observed number of cases in your sample fits what you expect given your knowledge of the population, you would reject the null hypothesis. True or False 1. A two-tailed hypothesis will have more statistical power than a...
1.) Which of the following is false? a.) The high degree of identical sequences between two...
1.) Which of the following is false? a.) The high degree of identical sequences between two people make finding DNA differences very difficult b.) The high amount of repeated regions in the human genome make it difficult to sequence and assemble c.) SNP comparisons require a reference where polymorphism sites are established within a population d.) Copy number variation can be identified by restriction enzymes in DNA fingerprinting assays e.) All of these statements are true. - 2.) What...
The Spearman correlation can be +1.00 or 1.00 even when there is no linear relationship between...
The Spearman correlation can be +1.00 or 1.00 even when there is no linear relationship between the two variables. Group of answer choices True False
A box plot can be used to examine the relationship between two variables. True or false...
A box plot can be used to examine the relationship between two
variables. True or false
Но Done Homework 2 2·True or False A boxplot can be used to examine therelationship between two variables. O True ○ False eBook
True or False? Epidemiological studies of the relationship between an exposure and a disease are susceptible...
True or False? Epidemiological studies of the relationship between an exposure and a disease are susceptible to the disturbing influences of extraneous factors called confounders.
A box plot can be used to examine the relationship between two
variables. True or false
Но Done Homework 2 2·True or False A boxplot can be used to examine therelationship between two variables. O True ○ False eBook
Most questions answered within 3 hours.
-
find the critical value associated with a right sided hypothesis of
the mean using a sample...
asked 1 hour ago -
Which of the following statements is true with respect to a
simple linear regression model?
a....
asked 2 hours ago -
The energy required to remove an electron from a surface of a
solid element is called...
asked 3 hours ago -
How would you train your employees to avoid risks of using
mobile devices?
asked 3 hours ago -
Assume Kw = 1.01 ✕ 10−14
For pure water, we can calculate [H3O+ ] = [OH...
asked 4 hours ago -
Suppose that on a temperature scale X, water boils at 203.0°X
and freezes at -105.7°X. What...
asked 5 hours ago -
BaS crystallizes in a cubic unit cell with S2- ions on each
corner and each face....
asked 6 hours ago -
A. 0≤P(Oi)≤10≤P(Oi)≤1 for each i
B. P(Oi)≤0P(Oi)≤0
C. P(Oi)=1+P(OCi)P(Oi)=1+P(OiC)
D. P(Oi)≥1P(Oi)≥1
If an experiment consists of...
asked 7 hours ago -
A battery has an emf of 9.20V and an internal resistance of 1.20
ohm. a)What resistance...
asked 7 hours ago -
The area of an elastic circular loop decreases at a constant
rate, dA/dt = −6.60×10−3 m2/s...
asked 8 hours ago -
The denaturation of proteins can be described by the
equilibrium
F⇌U
where F and U represent...
asked 10 hours ago -
Please answer what the maximum and minimum force is, and the
angle on the ion is...
asked 10 hours ago