Homework Answers
The Shine Dalgarno sequence is the sequence of nucleotides on the mRNA which is usually situated eight bases upstream from AUG (start codon) which has its critical roles in translation.
Here ,
a)
From (a) we can find the Shine Dalgarno sequence by counting bases upstream the start codon ; the sequence is identified as (read in 5' to 3' direction) UAGGAGG
b)
The midpoint of the Shine Dalgarno sequence can hence be identified from the DNA sequence in b .
Add Answer to:
mRNA Transcript and Features: 4 In sequence (b) below, use your mouse to click and mark...
1.A The mRNA sequence below is the full length of the mature mRNA transcript. On the...
1.A The mRNA sequence below is the full length of the mature mRNA transcript. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. This transcript arrives at a ribosome. Determine the anticodon sequence for the first three tRNA used to make the polypeptide. Label the 5’and 3’ends on the tRNAs. 5' AAUCGAUGUAAUCCGCAUC 3' B. Hydrolysis reactions They do so by link monomers to form a polymer; adding a water molecule remove monomers from...
Below is the mRNA sequence for the mRNA transcript used as the blueprint to make a...
Below is the mRNA sequence for the mRNA transcript used as the blueprint to make a specific protein. Write the DNA leading strain sequence, complimentary lagging stain sequence, and the protein with the amino acid sequence. Use the Codon Table provided. The mRNA transcript is provided for you. Leading strain : 5’ Lagging strain: 3’ mRNA transcript:5’ AUG UAC UAG GGC CCA AUU GAA ACG GGG ACC CCA GCC UGA3’ protein amino acid:
11. Using the DNA sequence below and the codon table on the projector, perform the following:...
11. Using the DNA sequence below and the codon table on the projector, perform the following: a. Produce the correct MRNA transcript. On the DNA sequence below, the top strand is the template strand, and transcription begins immediately following the promoter sequence and ends at the end of the DNA sequence. (5 points) b. Produce the correct polypeptide sequence. (5 points) Prometer GTCACGGGTACCCTGTGTTAAGGCATCGTATGATACATACCACTATGTACCATGGACACAATTCCGTAGCATAAGCATGACCC CAGTGCCCATGGGACACAATTCCGTAGCATACTATGTATGGTGATACATGGTACCTGTGTTAAGGCATCGTATTCGTACTGGG
11. Using the DNA sequence below and the codon table on the projector, perform the following:...
QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features...
QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding and sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 3: 5'ACTGCCCATGGTGGTACCT GAC TCC TGAGGAG 3' On the line above, write the sequence for the template DNA strand. On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the...
QUESTION 5 Match these terms to the descriptions below. b. , is added onto mRNA during...
QUESTION 5 Match these terms to the descriptions below. b. , is added onto mRNA during processing d , proteins that help initiate RNA synthesis a. spliceosome b. cap c. telomere d. transcription factors e. promoter a, removes introns from primary RNA transcript TATA-rich DNA sequence indicating the start site of a gene c repeating sequences found at the ends of linear DNA
1. How is the start codon identified in prokaryotic cells? a. It is the only AUG...
1. How is the start codon identified in prokaryotic cells? a. It is the only AUG on the mRNA strand. b. It is the AUG after the Shine-Dalgarno sequence. c. It is the AUG right next to the promoter on the mRNA. d. It is the AUG after the Kozak sequence. e. It is the AUG nearest the 5' end of the mRNA. 2. All of the following are true for eukaryotic transcription EXCEPT: a. Transcription can be terminated when...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized...
please explain a and b
shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
Overview The purpose of this activity is to help the students to understand how replication, tran...
TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...
1.A The mRNA sequence below is the full length of the mature mRNA transcript. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. This transcript arrives at a ribosome. Determine the anticodon sequence for the first three tRNA used to make the polypeptide. Label the 5’and 3’ends on the tRNAs. 5' AAUCGAUGUAAUCCGCAUC 3' B. Hydrolysis reactions They do so by link monomers to form a polymer; adding a water molecule remove monomers from...
11. Using the DNA sequence below and the codon table on the projector, perform the following: a. Produce the correct MRNA transcript. On the DNA sequence below, the top strand is the template strand, and transcription begins immediately following the promoter sequence and ends at the end of the DNA sequence. (5 points) b. Produce the correct polypeptide sequence. (5 points) Prometer GTCACGGGTACCCTGTGTTAAGGCATCGTATGATACATACCACTATGTACCATGGACACAATTCCGTAGCATAAGCATGACCC CAGTGCCCATGGGACACAATTCCGTAGCATACTATGTATGGTGATACATGGTACCTGTGTTAAGGCATCGTATTCGTACTGGG
11. Using the DNA sequence below and the codon table on the projector, perform the following:...
QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding and sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 3: 5'ACTGCCCATGGTGGTACCT GAC TCC TGAGGAG 3' On the line above, write the sequence for the template DNA strand. On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the...
QUESTION 5 Match these terms to the descriptions below. b. , is added onto mRNA during processing d , proteins that help initiate RNA synthesis a. spliceosome b. cap c. telomere d. transcription factors e. promoter a, removes introns from primary RNA transcript TATA-rich DNA sequence indicating the start site of a gene c repeating sequences found at the ends of linear DNA
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
please explain a and b
shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...
Most questions answered within 3 hours.
-
Find and , the mean and standard deviation of the
sampling distribution of :
μ = 25,...
asked 22 minutes ago -
According to the manufacturer of a certain candy, 9% of the
candy produced are red. If...
asked 40 minutes ago -
A Eucher Deck consists of 24 cards. In a four- player game, each
player is dealt...
asked 57 minutes ago -
This is a challenging question.
The titration of an impure sample of KHP found that 36.00...
asked 1 hour ago -
1. Starting from rest, an automatic subway train is controlled
by a computer
that causes it’s...
asked 22 minutes ago -
You place a block of
ice (mass of 3 kg) into a test chamber filled with...
asked 1 hour ago -
If a benzene ring has one -CF3 group as a
substituent, will the next substituent add...
asked 46 minutes ago -
CORPORATE FINANCE
STATEMENT: If the total risk of a stock is high you can
expect the...
asked 37 minutes ago -
Which of the following is true?
Select one:
a. The existence of generally accepted accounting principles...
asked 37 minutes ago -
What are the three characteristics of traditional "neighbor
ethics" that Jonas isolates, and in what respects...
asked 39 minutes ago -
A rectangular block that is 0.6m wide, 0.6m long and 1.2m high
stands on a horizontal...
asked 47 minutes ago -
3. Assume that a mining company that produces ore sells its
product for $40 per ton....
asked 41 minutes ago