Question

You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What peptide sequence would be produced if you inserted an extra "T" nucleotide in the DNA (between "A"&"C, as shown in the figure above) (use the 3-letter abbreviation for amino acids)? 15) What would happen if you deleted the DNA region that encodes the Shine-Dalgarno motif? (What would it affect, transcription or translation ? How ?

Answer 1

Let us begin with finding answers for Descriptive questions as in Question no. 15. Then we move on to first 2 questions.

15. The Shine–Dalgarno sequence, (named after John Shine and Lynn Dalgarno, who first described the
sequence) is a ribosomal binding site in mRNA, usually located Upstream, that means towards 5' side from the initiator codon AUG. It is necessary for the isolation of the initiator codon in the three dimentional coiled structure of mRNA. This isolation was accomplished by using ribonuclease to digest mRNA–ribosome complexes (formed under conditions in which protein synthesis could begin but elongation could not take place). The purine-rich, Shine–Dalgarno sequence pairs with the 16s rRNA. The 3' end of this rRNA component contains a sequence of several bases that is complementary to the purine-rich region in the initiator sites of mRNA.

Thus this motif helps in initiation of protein synthesis by 2 means -

(1) the pairing of mRNA bases with the 3' end of 16S rRNA and

(2) the Isolation & pairing of the initiator codon on mRNA with the anticodon of an initiator tRNA molecule.

So obviously, if we delete this motif in DNA, mRNA will not have this sequence, no attachment of ribosomal RNA with mRNA and improper pairing of initiator codon ---> No Translation of Protein from that mRNA. But Transcription in this case will be uneventful as this sequence is nothing to do with mRNA synthesis from DNA.

13. Now, the Shine dalgarno sequence has been mentioned, and we can see the First Codon in mRNA as AUG for Amino acid Methionine. And we can proceed with 3 letter codon after AUG.

Here UAA is the STOP codon which Terminates the Amino acid elongation. So last GCC-3' will not be translated to Amino acid.

14. Coming to this part, An Extra T nucleotide in DNA will Transcribed as A in mRNA. Then the synthesized peptide would be different from the previous one, as the FRAME Shifts for One Base.

And it will terminated in UAG as STOP codon. Again UAAGCC- 3' will not be translated in Amino acid.

Shine-Dalgarno motif Site of insertion for question 14 AGAGGUAGUUAAGCC -3 hine-Dalgarno moti Met Ser- Gly - Asn - Cys - Glu - Arg Term

Thanks for asking.