If you know the DNA sequence a gene, it is possible to determine the mRNA sequence and the amino acid (Protein) sequence.
If you only know the protein sequence, would you be able to accurately determine the mRNA sequence and DNA sequence? Explain.
If you know the DNA sequence a gene, it is possible to determine the mRNA sequence...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...
Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...
This assignment is worth four points. Create the sequence of a eukaryotic gene (DNA) that would: Be transcribed Encode a primary transcript that would be fully processed into mRNA, including having one intron spliced out Be translated into a protein with the amino acid sequence: MPLEASE. I suggest starting by writing out all of the sequence elements necessary for every step of transcription and translation, so that you make sure you include each of those elements in your gene. Report...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
Below is the mRNA sequence for the mRNA transcript used as the blueprint to make a specific protein. Write the DNA leading strain sequence, complimentary lagging stain sequence, and the protein with the amino acid sequence. Use the Codon Table provided. The mRNA transcript is provided for you. Leading strain : 5’ Lagging strain: 3’ mRNA transcript:5’ AUG UAC UAG GGC CCA AUU GAA ACG GGG ACC CCA GCC UGA3’ protein amino acid:
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...