Homework Answers
Add Answer to:
Below is an mRNA sequence and the peptide it encodes. What would happen if the 7th...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as...
The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as well as the type of single nucleotide mutation that produced each mutant polypeptide. Peptide sequence Type of mutation Wild type Met - Leu - Arg - Ile - ... Mutant 1 Met - Leu - Arg - Met -... transition Mutant 2 Met - Leu - [STOP] transition Mutant 3 Met - Phe - Arg - lle - ... transversion Determine the mRNA sequence...
7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first...
7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...
The following genomic DNA sequence comes from the first exon of a human gene and contains...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
please explain each question thoroughly. thanks Question 3: Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr-Leu-Trp-Ala-Ile-His-Phe-Ser-Cys-Lys a. What would happen if this peptide...
please explain each question thoroughly. thanks
Question 3: Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr-Leu-Trp-Ala-Ile-His-Phe-Ser-Cys-Lys a. What would happen if this peptide were to be incubated with dinitrofluorobenzene (FDNB) followed by 6M HCl hydrolysis at 1100C for 24 hrs. What labeled product(s) would be detected? Consider the following pepide: What would happen if the peptide were treated with CNBr? What would the products be? Why? b. What would happen if the peptide were treated with chymotrypsin? What would the c. products be? Why? Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr, Leu-Trp, Ala-Ile-His-Phe,...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as well as the type of single nucleotide mutation that produced each mutant polypeptide. Peptide sequence Type of mutation Wild type Met - Leu - Arg - Ile - ... Mutant 1 Met - Leu - Arg - Met -... transition Mutant 2 Met - Leu - [STOP] transition Mutant 3 Met - Phe - Arg - lle - ... transversion Determine the mRNA sequence...
7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
please explain each question thoroughly. thanks
Question 3: Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr-Leu-Trp-Ala-Ile-His-Phe-Ser-Cys-Lys a. What would happen if this peptide were to be incubated with dinitrofluorobenzene (FDNB) followed by 6M HCl hydrolysis at 1100C for 24 hrs. What labeled product(s) would be detected? Consider the following pepide: What would happen if the peptide were treated with CNBr? What would the products be? Why? b. What would happen if the peptide were treated with chymotrypsin? What would the c. products be? Why? Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr, Leu-Trp, Ala-Ile-His-Phe,...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
Most questions answered within 3 hours.
-
The outstanding bonds of Alpha Extracts have a yield to maturity
of 7.4 percent and a...
asked 20 minutes ago -
A 8.15- g bullet from a 9-mm pistol has a velocity of 366.0 m/s.
It strikes...
asked 23 minutes ago -
The Problem: The Case of the Harmonizing Vacations
Your CEO is exploring partnering with a European...
asked 1 hour ago -
A chemical equation is balanced by adding coefficients in front
of some formulas so that the...
asked 1 hour ago -
From the literature (reference your sources): What are the
lattice parameters of calcite and aragonite? Why...
asked 2 hours ago -
Your system is rejecting the question am asking which is
preceded by a case study. It...
asked 2 hours ago -
3. On January 2, 2000, Larry creates a trust with himself as
trustee. Larry as trustee...
asked 2 hours ago -
A member of the volleyball team spikes the ball. During this
process, she changes the velocity...
asked 2 hours ago -
Are adult gamers less likely to use a gaming console (Xbox,
PlayStation, Wii, etc...) than teen...
asked 3 hours ago -
The University of
Texas recently reported that 43% of college students aged 18-24
would spend their...
asked 3 hours ago -
The length of stay at a specific emergency department in
Phoenix, Arizona, in 2009 had a...
asked 2 hours ago -
. Please give the mechanism for this type of problem. Step by
Step
The toxin that...
asked 2 hours ago