Hello please please help !! Thank you!!
Please and thank you soo much!!!
In order to determine the amino acid for a given genetic code, we can do so using the codon table. As you can see that the codon table has three outer regions in blue, marked as First letter, Second letter and Third letter.
Now, the codon sequence given is 5'- AAG -3'.
In this codon, the First letter is A, Second letter is A and the Thrird letter is G.
We need to locate the AAG codon in the table and it will show which amino acid it codes for.
If you look at the codon table keenly enough, you would notice that the column to the left labeled "First letter" has 4 rows for each of the four nucleotides, UCAG.
That which is labeled "Second letter" has four columns for the 4 nucleotides, and for the third letter, there are 4 rows each within each of the 4 rows assigned for the first letter.
Now, the first step would be to find the first letter and fix that particular row. The first letter in AAG is A and so we need to look for the codon in the third row of the 'first letter' (red box) .
Next, we locate the second letter which is again "A" . Now we need to look at the third column under "second letter" and focus on the box (marked in blue) where the third column meets the third row of the first letter.
Finally, we look at the third letter G in the same blue box and find that the AAG codon (green) codes for the amino acid Lysine (where it says Lys).
The amino acid encoded by the mRNA codon "5'- AAG -3' is Lysine (Lys).
Hello please please help !! Thank you!! Please and thank you soo much!!! Question Completion Status:...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar Phosphate Bases: Adenine Guanine Cytosine Uracil 2. One nucleotide Note: Omit 3-6 if not using the DNA Structure and Function Kit. 3. Separated DNA 4. Template DNA with one complementary nucleotide of RNA hydrogen bonded 5. Template DNA with strand of mRNA hydrogen bonded 6. Separated mRNA and duplex DNA molecule 7. Completed mRNA with cap and tail 8. The cap 9. The tail...
mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha chain of human hemoglobin. Normal Karachi Chongqing Swan River ddATP ddCTP ATD about us Careers privacy policy terms of use contact us help ddATP ddCTP ddGTP ddTTP You can use the codon table to decode each amino acid sequence. For example, the first triplet in each sequencing chromatogram is GTG, which encodes for Val. What is the nature of the amino acid change in...
The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as well as the type of single nucleotide mutation that produced each mutant polypeptide. Peptide sequence Type of mutation Wild type Met - Leu - Arg - Ile - ... Mutant 1 Met - Leu - Arg - Met -... transition Mutant 2 Met - Leu - [STOP] transition Mutant 3 Met - Phe - Arg - lle - ... transversion Determine the mRNA sequence...
Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B. imaginarium (i.e. - after it is translated and released from the ribosome, a protease chews off a some amino acids). The wild-type enzyme, which has had the amino acids removed from the C’-terminus, is 246 amino acids in length and the C-terminal amino acids are shown below aligned with the C-terminal amino acids of a frameshift mutant, which – due to a frameshift mutation -...
base pairing Done stand is positively charged and th one strand contains only purind e DNA elych o ly me h 40) En me that wind the DNA strands during replication A. helicase B. mucienne E primase D. DNA polymerase 41) The leading and the lasing and differ in that A) the leading strand is synthesized in the same direction is the movement of the replication fork, and the lagring strand is synthesized in the opposite direction B) the leading...