Question

C++: Translating mRNA sequence help
Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide bases, where each 3-letter combination is codon for a single amino acid of a protein sequence. The ribosome will translate sets of 3 RNA bases into an amino acid chain based on the table below: Codon 2 Codon 3 Codon 4 Codon 5 Codon 6 Codon 7 RNA Ribonucleic acid Simplified Codon List Ribosome Translation Start Codon; Methionine (MET) Phenylalaine (PHE) Isoleucine (ILE) Valine (VAL) Stop Codon; No Amino Acid Alanine (ALA, A AUG UUU, UUC AUU, AUC, AUA GUU, GUC, GUA, GUG UGA Other For example, the mRNA sequence AUGUUCAUUGUUAAAUGA is translated to a protein sequence of 4 amino acids MET-PHE-ILE-VAL-ALA. Note that the final UGA is a stop codon and no amino acid is added for stop codons. Also note that any 3-letter combination not explicitly listed in the table (in this case AAA) is translated to Alanine based on your simplified codon list. Your job requires you to write a program that continually prompts the user for mRNA sequences, where the user presses enter after each sequence, and perform some analysis on that particular sequence until the user enters 'exit' for their sequence. A valid sequence is one with only A's, C's, G's and U's (case insensitive). Your program must check that the sequence: contains no letter other than A, C, G or U is entered (upper or lower case) is a multiple of3 begins with the start codon (AUG) ends with the stop codon (UGA) For valid sequences, your program should output the number of bases of each type (i.e. output the numbers of A, U, G, C bases) read in. Then translate the mRNA into its corresponding amino acid sequence and output the result to the user.

Answer 1

We just follow the problem definition. Here is the C++ code. Filename is amino_acid.cpp:

amino_acid.cpp:

#include<iostream>
#include<string>
#include<algorithm>
using namespace std;

string translate_acid(string sequence){
   /*
   * this function will translate the sequence to amino acid equivalent
   * we just iterate over the string in triads and check which ribosome to translate to by using mapping from codon to ribosome provided.
   */
   string acid = "";
   //first we convert sequence to uppercase
   transform(sequence.begin(), sequence.end(), sequence.begin(), ::toupper);
   //note we move counter three at a time to club all triads together
   for(string::iterator it=sequence.begin(); it!=sequence.end(); it+=3){
       char letter1 = *it;
       char letter2 = *(it+1);
       char letter3 = *(it+2);
       string s1 = "";
       s1.push_back(letter1);
       s1.push_back(letter2);
       s1.push_back(letter3);
       //we now compare s1 against codon list
       if(s1.compare("AUG") == 0){
           //this means it is "MET"
           //hence we add M, E, T to acid in succession
           //rest of the cases are filled in exactly in a similar fashion
           acid.push_back('M');
           acid.push_back('E');
           acid.push_back('T');
           acid.push_back('-');   //for separating acids
       }
       else if(s1.compare("UUU") == 0 or s1.compare("UUC") == 0){
           acid.push_back('P');
           acid.push_back('H');
           acid.push_back('E');
           acid.push_back('-');
       }
       else if(s1.compare("AUU") == 0 or s1.compare("AUC") == 0 or s1.compare("AUA") == 0){
           acid.push_back('I');
           acid.push_back('L');
           acid.push_back('E');
           acid.push_back('-');
       }
       else if(s1.compare("GUU") == 0 or s1.compare("GUC") == 0 or s1.compare("GUA") == 0 or s1.compare("GUG") == 0){
           acid.push_back('V');
           acid.push_back('A');
           acid.push_back('L');
           acid.push_back('-');
       }
       else if(s1.compare("UGA") == 0){
           //ending codon. we add nothing to acid
           //however we pop the '-' added because otherwise there will be a '-' at the end of the string.
           acid.pop_back();
       }
       else{
           //other case. we just add "ALA"
           acid.push_back('A');
           acid.push_back('L');
           acid.push_back('A');
           acid.push_back('-');
       }
   }
   return acid;
}

int count_bases(string sequence, char type){
   /*
   * this function will count the number of bases present of the given type
   */
   int count = 0;
   //first we transform both the type and sequence to upper case
   transform(sequence.begin(), sequence.end(), sequence.begin(), ::toupper);
   char u_type = toupper(type);
   for(string::iterator it=sequence.begin(); it!=sequence.end(); it++){
       char letter = *it;
       if(letter == u_type)
           count++;
   }
   return count;
}
      
int check_valid(string sequence){
   /*
   * this function checks validity of sequence and returns error codes as:
   * 0: sequence is valid
   * 1: sequence contains letters other than A, C, G, U.
   * 2: sequence length is not a multiple of 3
   * 3: sequence doesn't start with AUG
   * 4: sequence doesn't end with UGA
   */
   bool f1, f2, f3, f4;   //for capturing truth values of cases 1, 2, 3, 4 above
   bool f;    //this will be and of f1, f2, f3 and f4. i.e. only when all conditions are true, is the sequence valid.
   //for checking presence of letter other than A, G, U, C; we loop over the string and if other letter is found, we quit
   //first we convert sequence to uppercase using STL's transform function.
   //for checking we only use uppercases.
   f1 = true; f2 = true; f3 = true; f4 = true;
   transform(sequence.begin(), sequence.end(), sequence.begin(), ::toupper);
   for(string::iterator it=sequence.begin(); it!=sequence.end(); it++){
       char letter = *it;
       if(letter!='A' and letter!='C' and letter!='G' and letter!='U'){
           f1 = false;
           break;
       }
   }
   //now we check for sequence length
   if(sequence.length() % 3 != 0)
       f2 = false;
  
   //now we check for starting codon to be "AUG"
   //note arguments to compare function are: arg1: position of substring in sequence to start comparison from
   //arg2: length of substring in sequence to compare
   //arg3: string to compare against
   if(sequence.compare(0, 3, "AUG") != 0)
       f3 = false;
  
   //now we check for ending codon to be "UGA"
   if(sequence.compare(sequence.length() - 3, 3, "UGA") != 0)
       f4 = false;
  
   f = f1 and f2 and f3 and f4;
   if(f)
       return 0;
   else if(!f1)
       return 1;
   else if(!f2)
       return 2;
   else if(!f3)
       return 3;
   else
       return 4;
}

void input(){
   /*
   * this function will prompt user to enter mRNA sequence and..
   * will keep on prompting till user enter's exit.
   * at each string entered, we will call valid function to check if string is valid.
   * if it is valid, then we will count number of bases and call translate function to translate into amino acid.
   */
   cout << "Enter exit to stop the program\n";
  
   //we make while loop to exit when "exit" is entered by using a flag
   bool flag = false;
   string sequence;
   while(!flag){
       //we now read in the string entered by user
       cout << "Enter mRNA sequence(or exit to quit): ";
       cin >> sequence;
       //we now check if this equals "exit" or not
       if(sequence.compare("exit") == 0){
           flag = true;
           break;
       }
       //we now call check_valid function to check validity of mRNA sequence entered
       else{
           int status_code = check_valid(sequence);
           if(status_code == 0)
           {
               //we now count total bases for each type and translate it to amino acid
               cout << "Total counts of bases in the sequence: \n";
               cout << "A count: " << count_bases(sequence, 'a') << endl;
               cout << "C count: " << count_bases(sequence, 'c') << endl;
               cout << "G count: " << count_bases(sequence, 'g') << endl;
               cout << "U count: " << count_bases(sequence, 'u') << endl;
              
               string amino_acid = translate_acid(sequence);
               cout << "The amino acid corresponding to the mRNA " << sequence << " is: " << amino_acid << endl;
           }
           else{
               //we use status_code to capture the cause of invalidity of mRNA sequence entered.
               //we now use switch case to display correct reason for not accepting sequence.
               switch(status_code){
                   case 1: {cout << "The mRNA sequence contains letters other than A, C, G, U\n"; break;}
                   case 2: {cout << "The mRNA sequence length is not a multiple of 3\n"; break; }
                   case 3: {cout << "The mRNA sequence doesn't start with the start codon(AUG)\n"; break;}
                   case 4: {cout << "The mRNA sequence doesn't end with the stop codon(UGA)\n"; break;}
                   default: break;
               }//switch-case
           }//else
       }//else for sequence other than exit entered
   }//while
}//function

int main(){
   //here we use a function to take input loop
   input();
   return 0;
}
***********************************************************************************************

Sample Input and Outputs:

Enter exit to stop the program
Enter mRNA sequence(or exit to quit): AGUUGA
The mRNA sequence doesn't start with the start codon(AUG)
Enter mRNA sequence(or exit to quit): AUGGGU
The mRNA sequence doesn't end with the stop codon(UGA)
Enter mRNA sequence(or exit to quit): AUGCER
The mRNA sequence contains letters other than A, C, G, U
Enter mRNA sequence(or exit to quit): AUGUG
The mRNA sequence length is not a multiple of 3
Enter mRNA sequence(or exit to quit): AUGUGA
Total counts of bases in the sequence:
A count: 2
C count: 0
G count: 2
U count: 2
The amino acid corresponding to the mRNA AUGUGA is: MET
Enter mRNA sequence(or exit to quit): AUGUUCAUUGUUAAAUGA
Total counts of bases in the sequence:
A count: 6
C count: 1
G count: 3
U count: 8
The amino acid corresponding to the mRNA AUGUUCAUUGUUAAAUGA is: MET-PHE-ILE-VAL-ALA
Enter mRNA sequence(or exit to quit): AUGUUUAUAACAGUGGUUGUCUGA
Total counts of bases in the sequence:
A count: 6
C count: 2
G count: 6
U count: 10
The amino acid corresponding to the mRNA AUGUUUAUAACAGUGGUUGUCUGA is: MET-PHE-ILE-ALA-VAL-VAL-VAL
Enter mRNA sequence(or exit to quit): exit

************************************************************************************************