Homework Answers
Answer
The above diagram depicts the tryptophan operon regulation through the attenuation process. Specifically, in this image, it is clearly indicating that a lower level of tryptophan causes the formation of anti attenuator hairpin of leader sequence which allows the transcription of tryptophan synthesis gene to complete .
Add Answer to:
Describe what is happening in the figure below, and how this corresponds to levels of tryptophan...
Ok, let's now think about the circumstances under which attenuation would occur, vs. the scenario that...
Ok, let's now think about the circumstances under which attenuation would occur, vs. the scenario that would promote read-through (i.e. attenuation does not occur). Describe what is happening in the figure below, and how this corresponds to levels of tryptophan in the .cell (2 pts). RNA polymerase DNA Completed MKAIFVLKG leader peptide MU096 Ribosome mRNA 5 Attenuator structure Trp codons
V while translating the leader peptide of the tip operon the ribosome pauses on the tryptophan...
V while translating the leader peptide of the tip operon the ribosome pauses on the tryptophan codons, then O RNA polymerase will stop transcription of the trp operon 02. genes for cell dormancy are induced 3. the entire trp operon will be transcribed into mRNA. .4 the only peptide from the trp operon that will be produced is the leader peptide
The following activity will give you practice with the two operons we discussed - the lac...
The following activity will give you practice with the two operons we discussed - the lac operon and the trp operon. Below are two scenarios to consider. You will need to determine whether or not transcription is occurring and describe what is happening in the cell using our operon vocabulary words - regulatory gene, RNA polymerase, operator, promoter, repressor, and genes. 1. Bobby Joe just enjoyed an In and Out milkshake, how will the E. coli in her stomach respond?...
The following activity will give you practice with the two operons we discussed - the lac...
The following activity will give you practice with the two operons we discussed - the lac operon and the trp operon. Below are two scenarios to consider. You will need to determine whether or not transcription is occurring and describe what is happening in the cell using our operon vocabulary words - regulatory gene, RNA polymerase, operator, promoter, repressor, and genes. 1. Bobby Joe just enjoyed an In and Out milkshake, how will the E. coli in her stomach respond?...
P OPERON What happens to transcription at the trp operon when 1. tryptophan levels are low? Why? ...
P OPERON What happens to transcription at the trp operon when 1. tryptophan levels are low? Why? 2. Illustrate it. Include: RNA repressors erase, repressors, and any other molecules needed to show how this worke. GENE TURNED ON -+ + +- Promoter OperatorStructural Genes 3. What happens to transcription at the trp operon when trypto 4. Illustrate it. Include: RNA polymerase, e, repressors and any other molecules needed to show the following GENE TURNED OFF Promoter Operator Structural Genes Circle...
a) For the lac operon, will the repressor or RNA polymerase be bound to the operon in this situation? Draw what wil...
a) For the lac operon, will the repressor or RNA polymerase be bound to the operon in this situation? Draw what will be happening on the operon below. PROMOTER OPERATOR Lactose Enzyme 1 Lsctose Enzyme2 Lactose Enzyme 3 NO b) Will transcription occur? c) Describe what is happening (with vocabulary words). YES 2. Bobby Joe is fasting today, how will the E. coli in her stomach respond to the lack of Tryptophan? a) For the trp operon, will the repressor...
please all them Using the picture below, "G" represents a factor that fills in a small...
please all them
Using the picture below, "G" represents a factor that fills in a small gap between two DNA fragments by “sealing up" the phosphodiester backbone. This factor is called a: А A) single stranded binding protein B) ligase C) topoisomerase O A) single stranded binding protein B) ligase C) topoisomerase D) DNA polymerase III E) helicase Which of the lists below might contain sufficient ingredients to allow D. replication to occur in a test tube? A) primers, template...
here is the diagram ecause there is no repressor protein attached to the operator, what enzyme...
here is the diagram
ecause there is no repressor protein attached to the operator, what enzyme con attach to the promoter and move past the operator to transcribe the structural genes? Color this enzyme pink "color the repressor gene purple and the repressor protein it codes for red. Examine the shape of the repressor protein. 45) Is it an active or inactiverepressor protein? The diagram below shows the trp operon when turned off." Repressor gene Promoter Operator Structural genes DNA...
1. (4 pts) Is this figure happening in eukaryotes or prokaryotes and why? In this figure,...
1. (4 pts) Is this figure happening in eukaryotes or prokaryotes and why? In this figure, which mRNA was made first (1, 2, 3 or 4)? DNA initation site RNA polymerase mRNA 4 mRNA 3 RECA mRNA 2 TRANSLATION 75% $ Protein
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
Ok, let's now think about the circumstances under which attenuation would occur, vs. the scenario that would promote read-through (i.e. attenuation does not occur). Describe what is happening in the figure below, and how this corresponds to levels of tryptophan in the .cell (2 pts). RNA polymerase DNA Completed MKAIFVLKG leader peptide MU096 Ribosome mRNA 5 Attenuator structure Trp codons
V while translating the leader peptide of the tip operon the ribosome pauses on the tryptophan codons, then O RNA polymerase will stop transcription of the trp operon 02. genes for cell dormancy are induced 3. the entire trp operon will be transcribed into mRNA. .4 the only peptide from the trp operon that will be produced is the leader peptide
The following activity will give you practice with the two operons we discussed - the lac operon and the trp operon. Below are two scenarios to consider. You will need to determine whether or not transcription is occurring and describe what is happening in the cell using our operon vocabulary words - regulatory gene, RNA polymerase, operator, promoter, repressor, and genes. 1. Bobby Joe just enjoyed an In and Out milkshake, how will the E. coli in her stomach respond?...
The following activity will give you practice with the two operons we discussed - the lac operon and the trp operon. Below are two scenarios to consider. You will need to determine whether or not transcription is occurring and describe what is happening in the cell using our operon vocabulary words - regulatory gene, RNA polymerase, operator, promoter, repressor, and genes. 1. Bobby Joe just enjoyed an In and Out milkshake, how will the E. coli in her stomach respond?...
P OPERON What happens to transcription at the trp operon when 1. tryptophan levels are low? Why? 2. Illustrate it. Include: RNA repressors erase, repressors, and any other molecules needed to show how this worke. GENE TURNED ON -+ + +- Promoter OperatorStructural Genes 3. What happens to transcription at the trp operon when trypto 4. Illustrate it. Include: RNA polymerase, e, repressors and any other molecules needed to show the following GENE TURNED OFF Promoter Operator Structural Genes Circle...
a) For the lac operon, will the repressor or RNA polymerase be bound to the operon in this situation? Draw what will be happening on the operon below. PROMOTER OPERATOR Lactose Enzyme 1 Lsctose Enzyme2 Lactose Enzyme 3 NO b) Will transcription occur? c) Describe what is happening (with vocabulary words). YES 2. Bobby Joe is fasting today, how will the E. coli in her stomach respond to the lack of Tryptophan? a) For the trp operon, will the repressor...
please all them
Using the picture below, "G" represents a factor that fills in a small gap between two DNA fragments by “sealing up" the phosphodiester backbone. This factor is called a: А A) single stranded binding protein B) ligase C) topoisomerase O A) single stranded binding protein B) ligase C) topoisomerase D) DNA polymerase III E) helicase Which of the lists below might contain sufficient ingredients to allow D. replication to occur in a test tube? A) primers, template...
here is the diagram
ecause there is no repressor protein attached to the operator, what enzyme con attach to the promoter and move past the operator to transcribe the structural genes? Color this enzyme pink "color the repressor gene purple and the repressor protein it codes for red. Examine the shape of the repressor protein. 45) Is it an active or inactiverepressor protein? The diagram below shows the trp operon when turned off." Repressor gene Promoter Operator Structural genes DNA...
1. (4 pts) Is this figure happening in eukaryotes or prokaryotes and why? In this figure, which mRNA was made first (1, 2, 3 or 4)? DNA initation site RNA polymerase mRNA 4 mRNA 3 RECA mRNA 2 TRANSLATION 75% $ Protein
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
Most questions answered within 3 hours.
-
Explain in detail whether the following is true or false:
Total factor productivity will rise only...
asked 5 minutes ago -
The life expectancy of sport utility vehicles follows a normal
distribution with a mean of 145.8...
asked 7 minutes ago -
A firm pays a $2.50 dividend at the end of year one
(D1), has a stock...
asked 7 minutes ago -
The waiting time in line at an ice cream shop has a uniform
distribution between 0...
asked 27 minutes ago -
The term “corporatization” is often used in the former socialist
economies to describe
changing the way...
asked 30 minutes ago -
what sort of treatment is planned for a barrel of wine to be
"aged" for sale?...
asked 46 minutes ago -
What is the energy of 500 nm green light, in kilojoules per mole
of photons?
asked 45 minutes ago -
2. Your brother, who is 6 years old, just received a trust fund
that will be...
asked 56 minutes ago -
Sixty percent of teachers at a high school are female. Forty
percent of the teachers are...
asked 1 hour ago -
Evaluate for A = 6, B = 4, and C =
2.
F = A ^...
asked 1 hour ago -
how do I determine %yield and theoretical yield from
Fisher esterification reaction?
Glacial acetic acid M.W=...
asked 1 hour ago -
The wine industry is characterized by thousands of vineyards
selling a variety of wines (Chardonnay, Sauvignon...
asked 1 hour ago