From the perspective of biology, what should be the criteria for a gene/protein to be considered...

Question

Question

From the perspective of biology, what should be the criteria for a gene/protein to be considered a good target for drugging in cancer?

Answer 1

Answer #1

Criteria for a gene/protein to be a good target for drugging in cancer:

1. Involve in cell growth and survival.

II. Can be modulated without killing the host.

III. Have a unique structure sufficient enough to differentiate.

IV. Have a known Molecular structure to design a structure based drug.

V. Are mutant proteins produce by cancer cells to drive cancer progression.

VI. Present / abundant in cancers cells but not in normal cells.

VII. Fusion protein (product of fusion gene) formed because of the abnormalities in chromosomes present in cancer cells.

Answer 2

Similar Homework Help Questions

From a quality perspective, what criteria should be included in the credentialing and recredentialing processes. Please...

From a quality perspective, what criteria should be included in the credentialing and recredentialing processes. Please respond with at least one credible citation.
For Biology of Cancer- Please Explain The regulation of expression of the Ah locus, the protein...

For Biology of Cancer- Please Explain The regulation of expression of the Ah locus, the protein products regulated by the activities of each gene, the mechanisms of AH-induced gene expression. Should be able to reason (and give an example) on how a selective or aberrant regulation of the Ah-locus might affect the predisposition to malignancies associated with exposure to AH (such as in smoking).
Should the Reconstruction era be considered the Second American Revolution? By what criteria should we make such a judge...

Should the Reconstruction era be considered the Second American Revolution? By what criteria should we make such a judgement?

What is the relationship between protein translation and gene expression? Would you expect to always see...

What is the relationship between protein translation and gene expression? Would you expect to always see correlation between these two? Discuss a circumstance within the context of cancer where mRNA and protein expression may not correlate. Why is it important to look at both protein and RNA levels of a series of genes/proteins in a molecular pathway? Discuss this in the context of cancer associated pathways. Give a specific example of a pathway that is independent of gene expression in...
(Molecular Biology) Explain what a gene is, and what isoforms are & how a gene can...

(Molecular Biology) Explain what a gene is, and what isoforms are & how a gene can have 2 different isoforms, and further explain how exons can splice together to form the 2 different isoforms.
What would be considered good selection criteria for a buyer to use to select a seller?

What would be considered good selection criteria for a buyer to use to select a seller?

How can a corporate strategy benefit from incorporating a green marketing perspective? What issues should be...

How can a corporate strategy benefit from incorporating a green marketing perspective? What issues should be considered when incorporating a green marketing perspective? Provide specific examples to support your answers
analyze the criteria that should be considered to examine that: the economy teaches us the fundamental...

analyze the criteria that should be considered to examine that: the economy teaches us the fundamental aspects of decision making
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’...

Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005

IN CONTEXT OF GENE EXPRESSION AND PROTEIN SYNTHESIS OUTCOME 5. a), Why are Proto-Oncogenes important for...

IN CONTEXT OF GENE EXPRESSION AND PROTEIN SYNTHESIS OUTCOME 5. a), Why are Proto-Oncogenes important for the cell cycle control and what is their implication in a progression of tumors and cancers? Provide examples of TWO proto-oncogenes and a type of a cancer each is associated with. (6 pts) b) Now consider the diagram below. Under each of three scenarios, explain a likely cellular consequence relative to gene expression and protein synthesis outcome, assuming each could lead to a development...