Calculate the minimum length of time required for E. coli RNA polymerase to synthesize an mRNA...
Calculate the minimum length of time required for E. coli RNA polymerase to synthesize an mRNA that encodes a 100 kDa protein. The molecular weight of an amino acid is approximately 110 Da. E. coli RNA polymerase has a transcription rate of approximately 50 nucleotides per second. Round your answer to the nearest whole number.
Homework Answers
A 100-kd protein contains about 910 residues, which are encoded by 2730 nucleotides. At a maximal transcription rate of 50 nucleotides per second, the protein would be synthesized in 54.6 s.
Add Answer to:
Calculate the minimum length of time required for E. coli RNA
polymerase to synthesize an mRNA...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
DNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication
Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...
Why does E. coli have several different sigma factors? A.They allow RNA polymerase I, RNA polymerase...
Why does E. coli have several different sigma factors? A.They allow RNA polymerase I, RNA polymerase II and RNA polymerase III to bind to different promoters. B.They allow the different subunits of the RNA polymerase holoenzyme to bind to each other. C.They are redundant in case one is mutated. They all perform the same function. D.One is needed to transcribe mRNA. A second is needed to transcribe tRNA. And a third is needed to transcribe rRNA. E.They are used if...
A cukaryotic pre-mRNA transcript has 5 exoms and 4 introms of variable length, according to the...
A cukaryotic pre-mRNA transcript has 5 exoms and 4 introms of variable length, according to the following table. The average molecular weight of an amino acid is 110 Calculate the approximate molecular weights (in kDa) of the proteins resulting from pre-mRNA, that undergoes alternative to include exoms 1+2+3+4, KDa
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
Which of the following statements is true? A. RNA polymerase has a proofreading activity B. Prokaryotic...
Which of the following statements is true? A. RNA polymerase has a proofreading activity B. Prokaryotic RNA usually undergoes nuclear processing C. Polypeptides are synthesized by addition of amino acids to the amino terminus. D. The 3' end of mRNA corresponds to the carboxyl terminus of the protein. Grade 2. Which of the following A. It may be autocatalytic. B. Spliceosomes are present in organelles and nuclei C. It involves removal of exons is true regarding RNA processing? D. It...
moose the correct alphabet (letter, noting that each and may have only ch answer can be...
moose the correct alphabet (letter, noting that each and may have only ch answer can be used more than once Answers a Eukaryotic mRNAS b.Prokaryotic mRNAs e . Transfer RNAS d. RNAs f. All RNAS e. Pre-mRNA the have a cloverleaf structure are synthesized by RNA polymerases the RNA that has the anti-codon are the template of genetic information during protein synthesis contains exons and introns is a structural component of the ribosome is the RNA that goes into the...
13. Why are ribonucleoside triphosphates the monomers required for RNA synthesis rather than ribonucleoside monophosphates? A....
13. Why are ribonucleoside triphosphates the monomers required for RNA synthesis rather than ribonucleoside monophosphates? A. Only ribonucleoside triphosphates contain the sugar ribose. B. Ribonucleoside triphosphates have low potential energy, making the polymerization reaction endergonic. C. Ribonucleoside triphosphates have high potential energy, making the polymerization reaction exergonic. D. Ribonucleoside monophosphates cannot form complementary base pairs with the DNA template. E. Ribonucleoside triphosphates are not used, rather all use deoxyriboside triphosphates. 14. How is a mutation in a bacterial cell that...
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of...
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...
7. Protein purification. As a graduate student, the first protein I purified was RNA polymerase (RNAP)...
7. Protein purification. As a graduate student, the first protein I purified was RNA polymerase (RNAP) from E. coli. Some physical and chemical properties of E. coli RNAP Molecular mass = 470,000 g/mol polypeptide composition (subunits): a (50 kDa), B (150 kDa) and 6 (70 kDa) pl = 5.34 substrates: NTPS cofactor: Mg Purification protocol. E. coli cells were broken using lysozyme, yielding a cellualar extract containing a proteome solution. 4M (NH4)2SO4 was added to the cellular extract. A white...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
A cukaryotic pre-mRNA transcript has 5 exoms and 4 introms of variable length, according to the following table. The average molecular weight of an amino acid is 110 Calculate the approximate molecular weights (in kDa) of the proteins resulting from pre-mRNA, that undergoes alternative to include exoms 1+2+3+4, KDa
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
Which of the following statements is true? A. RNA polymerase has a proofreading activity B. Prokaryotic RNA usually undergoes nuclear processing C. Polypeptides are synthesized by addition of amino acids to the amino terminus. D. The 3' end of mRNA corresponds to the carboxyl terminus of the protein. Grade 2. Which of the following A. It may be autocatalytic. B. Spliceosomes are present in organelles and nuclei C. It involves removal of exons is true regarding RNA processing? D. It...
moose the correct alphabet (letter, noting that each and may have only ch answer can be used more than once Answers a Eukaryotic mRNAS b.Prokaryotic mRNAs e . Transfer RNAS d. RNAs f. All RNAS e. Pre-mRNA the have a cloverleaf structure are synthesized by RNA polymerases the RNA that has the anti-codon are the template of genetic information during protein synthesis contains exons and introns is a structural component of the ribosome is the RNA that goes into the...
13. Why are ribonucleoside triphosphates the monomers required for RNA synthesis rather than ribonucleoside monophosphates? A. Only ribonucleoside triphosphates contain the sugar ribose. B. Ribonucleoside triphosphates have low potential energy, making the polymerization reaction endergonic. C. Ribonucleoside triphosphates have high potential energy, making the polymerization reaction exergonic. D. Ribonucleoside monophosphates cannot form complementary base pairs with the DNA template. E. Ribonucleoside triphosphates are not used, rather all use deoxyriboside triphosphates. 14. How is a mutation in a bacterial cell that...
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...
7. Protein purification. As a graduate student, the first protein I purified was RNA polymerase (RNAP) from E. coli. Some physical and chemical properties of E. coli RNAP Molecular mass = 470,000 g/mol polypeptide composition (subunits): a (50 kDa), B (150 kDa) and 6 (70 kDa) pl = 5.34 substrates: NTPS cofactor: Mg Purification protocol. E. coli cells were broken using lysozyme, yielding a cellualar extract containing a proteome solution. 4M (NH4)2SO4 was added to the cellular extract. A white...
Most questions answered within 3 hours.
-
In #13-16, use the following information. At the 0.01 level of
significance, test the claim that...
asked 13 seconds from now -
Suppose you wanted to make a buffer with pH 3.00. What chemicals
would you grab off...
asked 18 minutes ago -
A 195 g mass attached to a horizontal spring oscillates at a
frequency of 5.20 Hz...
asked 3 minutes ago -
Given the reaction where 1.00 mol H2(g) is burned in excess
O2(g) at 25 °C,
H2(g)...
asked 12 minutes ago -
Many celebrities and public figures have Twitter accounts with
large numbers of followers. However, some of...
asked 20 minutes ago -
Elemental phosphorus is produced by the reaction, 2Ca3(PO4)2
+6SiO2 +10C→6CaSiO3 +10CO+P4 Suppose that you have 7.00...
asked 20 minutes ago -
A nationwide survey found that 64% of people in the
Kingdom like Berger. If 3 people...
asked 32 minutes ago -
CYTOGENETIC MAPS VS LINKAGE MAPS
how do you read and extract information from cytogenetic and
linkage...
asked 34 minutes ago -
What volume of a 0.251 M perchloric
acid solution is required to neutralize
14.6 mL of...
asked 34 minutes ago -
Amplitude=3;
fs=8000;
n=0:399;
t=0:1/fs: n*1/fs-1/fs;
signal=3+3*cos(2*pi*1100*t)+3*cos(2*pi*2200*t)+3*cos(2*pi*3300*t);
fftSignal= fft(signal);
fftSignal=f ftshift (fftSignal);
f=fs/2*linspace(-1,1,fs);
plot(f,abs(fftsignal);
xlabel('Frequency(Hz)’)
yla
asked 35 minutes ago -
Write a method called removeDuplicates that
accepts a PriorityQueue of integers as a parameter
and modifies...
asked 37 minutes ago -
What is the wavelength, in cm, of a microwave having a frequency
of 3.44 x 10^9...
asked 55 minutes ago