Homework Answers
Ans-22- from the arrow it is clear that both produces sticky end after cleavage. Blunt ends are produced only when the cleave is straight perpendicular to the DNA.
Ans-23- since mitochondrial DNA is circular, number of fragments generated after cleavage would be equal to number of restriction site. So 4 is correct answer
Add Answer to:
You are performing an analysis of squirrel mitochondrial DNA, which is a circular double-stranded DNA molecule...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...
1. You perform a restriction endonuclease assay on an uncharacterized DNA molecule, using Pstl, Sall, and...
1. You perform a restriction endonuclease assay on an uncharacterized DNA molecule, using Pstl, Sall, and Xhol. When you run the DNA on a 1% agarose gel, you obtain the following information regarding fragment number and length (all lengths are in bp): Pstl (P) 700 200 Sall(s) 600 300 Xhol (X) 500 350 50 Pstl + Sall (P+S) 600 200 100 Pstl + Xhol (P+X) 500 200 150 50 Sall + Xhol (S+X) 500 250 100 50 Solve the following...
You are given a circular DNA molecule to analyze that is 3,000bp (3 Kb) long. You...
You are given a circular DNA molecule to analyze that is 3,000bp
(3 Kb) long. You proceed to treat the DNA molecule with different
cutting enzymes and then you run the individual reactions on a gel.
The following gel is produced with each column representing a
different reaction (lane). In lane 1 a molecule weight ladder is
run. In lane 2, the circular DNA is NOT treated with any enzyme. In
lane 3 the DNA is treated with an enzyme...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...
A linear piece of DNA has the following restrictions sites: You decided to set up an...
A linear piece of DNA has the following restrictions sites:
You decided to set up an experiment where you added one of these
restriction enzymes to this DNA. After this DNA was digested with
that restriction enzyme, you separated the resulting fragment(s)
using agarose electrophoresis. After the gel was stained with
ethidium bromide, you observed the following gel (the DNA ladder is
your reference standard and is comprised of a series of DNA
fragments of known length).
a) Which restriction...
please answer question numbe 2. Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA...
please answer question numbe 2.
Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA strands at specific recognition sequences. They evolved to protect bacteria from bacterial viruses and are very useful for a wide variety of molecular biology applications. Some of the more common ones include EcoRI which recognizes the 6 bp sequence 5 'GAATTC 3' and cleaves the phosphodiester backbone after the G. Hind III_(AAGCTT), BamHI (G|GATCC), Pstl (CTGCAG), Not! (GC|GGCCGC), Ndel (CATATG) Kpnl (GGTAC^C), Bgl II...
Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel...
Chromosomal and plasmid DNA can be cut into manageable pieces by
restriction enzymes. Using agarose gel electrophoresis, the DNA
fragments can be separated on a gel, based on their lengths. In
order to see the fragments, a stain is typically added to the gel.
The size of each fragment can be determined by comparing each one
to a DNA molecular weight marker of known size.
Below is a map of pBR22 plasmid. The position and base pair
number of the...
In your previous prac session you digested your POTC-A plasmid DNA with 3 enzyme mixes (AB...
In your previous prac session you digested your POTC-A plasmid DNA with 3 enzyme mixes (AB and C). One mix contained the restriction endonuclease Kpnl alone, another contained both del and Not and another contained Sphi and Nhe, but you don't know which was which yet. The sites where these enzymes cut POTC-A are indicated on the plasmid map at the top of the page. Calculate the sizes of the DNA fragments that you would expect to see on your...
please help if you can 3. You cloned a 20 kb piece of DNA, which contains...
please help if you can
3. You cloned a 20 kb piece of DNA, which contains restriction sites as shown below. 281534 5 B 4 & 5 B = BamHl site, E = EcoRI site, H = Hindill site Numbers above the segments represent the sizes of the regions in kb. Draw and label (in the agarose gel below) the sizes of the fragments you would expect to see after complete digestion of this piece of DNA with the following...
8. You are studying a newly identified chromatin-remodeling complex, which you call NICRC. You decide to...
8. You are studying a newly identified chromatin-remodeling complex, which you call NICRC. You decide to run an in vitro experiment to characterize the activity of the purified complex. Your molecular toolbox includes: (1) a 400-base-pair DNA molecule that has a single recognition site for the restriction endonuclease EcoRI, an enzyme that cleaves internal sites on double-stranded DNA (dsDNA); (2) purified EcoRI enzyme; (3) purified DNase I, a DNA endonuclease that will cleave dsDNA at nonspecific sites if they are...
1. You perform a restriction endonuclease assay on an uncharacterized DNA molecule, using Pstl, Sall, and Xhol. When you run the DNA on a 1% agarose gel, you obtain the following information regarding fragment number and length (all lengths are in bp): Pstl (P) 700 200 Sall(s) 600 300 Xhol (X) 500 350 50 Pstl + Sall (P+S) 600 200 100 Pstl + Xhol (P+X) 500 200 150 50 Sall + Xhol (S+X) 500 250 100 50 Solve the following...
You are given a circular DNA molecule to analyze that is 3,000bp
(3 Kb) long. You proceed to treat the DNA molecule with different
cutting enzymes and then you run the individual reactions on a gel.
The following gel is produced with each column representing a
different reaction (lane). In lane 1 a molecule weight ladder is
run. In lane 2, the circular DNA is NOT treated with any enzyme. In
lane 3 the DNA is treated with an enzyme...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...
A linear piece of DNA has the following restrictions sites:
You decided to set up an experiment where you added one of these
restriction enzymes to this DNA. After this DNA was digested with
that restriction enzyme, you separated the resulting fragment(s)
using agarose electrophoresis. After the gel was stained with
ethidium bromide, you observed the following gel (the DNA ladder is
your reference standard and is comprised of a series of DNA
fragments of known length).
a) Which restriction...
please answer question numbe 2.
Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA strands at specific recognition sequences. They evolved to protect bacteria from bacterial viruses and are very useful for a wide variety of molecular biology applications. Some of the more common ones include EcoRI which recognizes the 6 bp sequence 5 'GAATTC 3' and cleaves the phosphodiester backbone after the G. Hind III_(AAGCTT), BamHI (G|GATCC), Pstl (CTGCAG), Not! (GC|GGCCGC), Ndel (CATATG) Kpnl (GGTAC^C), Bgl II...
Chromosomal and plasmid DNA can be cut into manageable pieces by
restriction enzymes. Using agarose gel electrophoresis, the DNA
fragments can be separated on a gel, based on their lengths. In
order to see the fragments, a stain is typically added to the gel.
The size of each fragment can be determined by comparing each one
to a DNA molecular weight marker of known size.
Below is a map of pBR22 plasmid. The position and base pair
number of the...
In your previous prac session you digested your POTC-A plasmid DNA with 3 enzyme mixes (AB and C). One mix contained the restriction endonuclease Kpnl alone, another contained both del and Not and another contained Sphi and Nhe, but you don't know which was which yet. The sites where these enzymes cut POTC-A are indicated on the plasmid map at the top of the page. Calculate the sizes of the DNA fragments that you would expect to see on your...
please help if you can
3. You cloned a 20 kb piece of DNA, which contains restriction sites as shown below. 281534 5 B 4 & 5 B = BamHl site, E = EcoRI site, H = Hindill site Numbers above the segments represent the sizes of the regions in kb. Draw and label (in the agarose gel below) the sizes of the fragments you would expect to see after complete digestion of this piece of DNA with the following...
8. You are studying a newly identified chromatin-remodeling complex, which you call NICRC. You decide to run an in vitro experiment to characterize the activity of the purified complex. Your molecular toolbox includes: (1) a 400-base-pair DNA molecule that has a single recognition site for the restriction endonuclease EcoRI, an enzyme that cleaves internal sites on double-stranded DNA (dsDNA); (2) purified EcoRI enzyme; (3) purified DNase I, a DNA endonuclease that will cleave dsDNA at nonspecific sites if they are...
Most questions answered within 3 hours.
-
For the following reaction, 0.128 moles of
potassium hydrogen sulfateare mixed with
0.504 moles of potassium...
asked 3 hours ago -
1. What is the present value of $400, three years in the future
if the interest...
asked 3 hours ago -
The labor force minus the number of employed equals the number
of unemployed.
a. True
b....
asked 5 hours ago -
Determine the mass in units of grams [g] of 0.49 moles [mol]
of a new fictitious...
asked 6 hours ago -
A horizontal mass of M=5kg is on a spring and stretched to
x=0.5m when released from...
asked 7 hours ago -
26 of 50
"I have worked at the Arizona Humane Society for ten years, and
have...
asked 7 hours ago -
Compare and contrast zero based budgeting and incremental (or
base year) budgeting.
asked 7 hours ago -
4 pts 10. Which of the following hypothesis would be MOST
difficult to test experimentally? Group...
asked 7 hours ago -
A business owner makes 1,000 items a day. Each day he or she
contributes eight hours...
asked 7 hours ago -
A
circular loop in the plane of a paper lies inca0.65 T magnetic
field pointing into...
asked 8 hours ago -
A business owner is trying to decide whether to buy, rent, or
lease office space and...
asked 8 hours ago -
Thermal Storage Solar heating of a house is much more efficient
if there is a way...
asked 8 hours ago