Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel electrophoresis, the DNA fragments can be separated on a gel, based on their lengths. In order to see the fragments, a stain is typically added to the gel. The size of each fragment can be determined by comparing each one to a DNA molecular weight marker of known size.
Below is a map of pBR22 plasmid. The position and base pair number of the recognitions sequence for different restriction enzymes is indicated. The fat arrows designate the position and size of several genes, for example, ampicillin and tetracycline resistance.
Using the attached plasmid restriction map answer the following questions.
Use the following as a marker (M)
Post lab questions:
RESTRICTION MAP: P.S. THERE IS NO MORE INFO. THIS IS ALL MY TEACHER GAVE US FOR INFO.
Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel...
Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb). Using this map as a guide, give the number of restriction fragments along with their associated lengths that would result from digesting PGEN101 with the restriction enzymes EcoRI, BamHII, anda combination of EcoRI + BamHI. BamHI BamHI BamHI / PGEN101 (20 kb) Mb EcoRI Digest Performed Size Emments Obtained EcoRI........ BamHI.. EcoRI + BamHI.... Two freshmen college students, interested in becoming gene jocks, performed...
8. DNA cloning. The first DNA clone using recombinant DNA technology was human insulin, which was made in 1978. The insulin gene was inserted into a plasmid and the gene was transcribed and translated from the plasmid in E coll cells. Insulin is synthesized by ribosomes in human pancreatic cells. Insulin is synthesized as a longer polypeptide, which is then trimmed by proteases to make the mature chains A and B (see Fig. 2.17 on page 39 of your textbook)....
A student clones a DNA fragment into the Sall site of pBR322. Sall is a restriction enzyme and pBR322 is the name of a plasmid (diagram below). Predict the media on which she could expect growth of E. coli containing the recombinant plasmid. Explain your answers. (16 pts) 2. EcoRI BamHI Pst Sall Ampicillin Tetracycline resistance (AmpR) resistance (TetR) pBR322 (4,361 bp) Origin of replication (ori) Pvull Media nutrient agar with ampicilin nutrient agar with tetracycline nutrient agar with ampicillin...
A plasmid is cleaved by restriction endonucleases and analyzed by agarose gel electrophoresis. Assume there is no supercoiling. Answer the following three questions about the plasmid. Can you please help below? I also don't understand it so a explanation for each would be helpful. For the first one I think its 1000bp but unsure. For the second, I think there is 2 HindIII sites and for the last one there is 1 EcoRI site? Please explain. A plasmid is cleaved...
B4. Answer ALL parts: The diagram below shows the restriction pattern of a plasmid cut with the enzymes BamHI, EcoRI and Ndel. The digests are carried out with each enzyme alone and then with different combinations of the three enzymes. Enzyme Fragment sizes kb BamHI 1.4 10.6 EcoRI 4.5 7.5 Ndel 2.5 9.5 BamHI + EcoRI 45 3.4 1.4 BamHI + Ndel 1.4 2.5 5.9 EcoRI + Ndel 0.5 2.0 2.5 7.0 (a) Draw an agarose gel with restriction fragments...
The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...
7. Explain the procedure for cloning DNA fragment into the plasmid PBR322 (shown on the right) (S pts.). The gene fragment of interest was obtained by digestion of chromosomal DNA with the restriction enzyme Sall and subsequent purification using agarose gel electrophoresis. Which antiblotic would you use in the final step of the cloning procedure, and Pst why? EcoR Sal Ampicillin Tetracycline resistanica(Ter Amp) PBR322 4,361 bp) Origin of replicatiorn (ori Pvull 8. Assume that your gene fragment from question...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...
A polylinker increases the versatility of a DNA plasmid because it: (select all correct answers) A) facilitates the cloning of DNA segments. B) contains a DNA sequence that confers resistance to ampicillin. C) contains a DNA sequence to allow the vector to replicate. D)contains DNA recognition sequences for several different restriction enzymes. 2. You have an E. coli plasmid whose sequence contains three EcoRI restriction sites. How many DNA fragments would result from a complete EcoRI restriction enzyme digest? a....
please help me with these questions Lab 8 Extension Activity: Plasmid Mapping and Restriction Enzymes Mapping the Plasmid The first step in mapping a plasmid is to determine how many times a restriction site is found on that plasmid. Examine the results for plasmid 55 as an example. The data given in the following table are for the double digest using EcoRI and Pstl. Also, giving are the data for single digests by the individual enzymes. The numbers in the...