Question

4. Here is an RNA transcript freshly transcribed from a gene. It is immature, meaning that it has not been processed yet into a mature mRNA. a) If you could zoom in on this molecule, what two things would you observe at the molecular level that would indicate to you that it is RNA and not DNA? b) Which end of the molecule was the last bit to be transcribed, at the 5' end, or at the 3 end? How do you know this? c) On the molecule above, indicate for it the +1 site, 5'UTR, 3'UTR, 3 exons, and 2 introns. Draw the exons as boxes and otherwise label the other regions with text and arrows. d) Now draw your transcript from above after it has been processed into a mature RNA, indicating the 3 modifications that have occurred. 5. Below is a part of an mRNA transcript showing two exons and the intervening intron. 5' - Exon 1 – Exon 2 3 a) Indicate in the spaces shown the bases that must be present if splicing is to occur. b) Describe the 6 steps by which the intron will be spliced out. Be sure to use the word 'spliceosome' somewhere in your answer.
Can someone please help with these two questions? Thank you.

Answer 1

4.

• Transcription is the process by which DNA sequence is copied to mRNA, by enzyme RNA polymerase. Initiation of transcription involve formation of initiation complex. This involves binding of transcriptional factors on specific sequence on promoter that determines the binding of RNA polymerase, to form transcriptional initiation complex.

a.

• RNA has Ribose as pentose sugar. Its structure has OH group attached to the second carbon atom (called 2 prime or 2’). Thus, RNA is designated as Ribonucleic acid (for ribose).
• DNA has Deoxyribose as pentose sugar. Its structure has H group attached to the second carbon atom, replacing the OH group (hence deoxy). Thus, DNA is designated as Deoxyribonucleic acid (for Deoxyribose).
• .Pyrimidine- DNA has Thymine (T) and Cytosine (C). RNA has Uracil (U) and Cytosine (C).

b.

• 5’ to 3’ strand of DNA serve as coding strand.
• 3’ to 5’ strand of DNA act as template strand.
• RNA is synthesized by complementary base pairing with the template strand.
• Thus, the RNA will have same sequence as coding strand (only T is replaced by U) and is oriented in 5’ to 3’ direction.

c.

Pre-mRNA:

5’ TGAGACTGTTGACCGCGATTTATATGCATGTGAT( Transcription start site-+1)

AGGAAAUGAAAUGCCA-gaauugccggaugac-GGUCAGC-aaucga-GCACAUUUGUGAUUUACCGU-3’

              Exon 1 Intron 1 Exon 2 Intron2 Exon 3

d.

         Mature-mRNA:

5’ CH3-AGGAA-AUG(start codon)AAAUGCCAGGUCAGCGCACAUUUGUGA(Stop)UUUACCGU-3’AAAAAA

Cap     5’UTR 3’UTR                 Poly A tail

5.

· For translation, mRNA moves to the cytoplasm, where it is subjected to constant degradation. Thus, Post-transcriptional processing of mRNA is essential.

· The half-life depends on the stability of the mRNA, that in turn is determined by capping (methylation) at 5’ end and poly A tail (polyadenylation) at 3’ end.

· Many eukaryotic gene contain, regions of “expressed sequence” or exons, which code for proteins and non-coding or” intervening sequence” or introns.

· The pre-RNA transcript requires splicing process, by which introns are removed, exons are joined to form mature RNA. The process of splicing is mediated by small nuclear ribonuclear proteins (snRNPs or SNURPS).

· Thus, the mRNA obtained by transcription is the pre-mRNA, which is converted to mature RNA by RNA processing.

· The proteins interact specifically with snRNA or small nuclear RNA for pre-mRNA processing.

· snRNA has specific sequences, based on which they are designated as U1 to U6.

· The U1 snRNA help in initiation of RNA processing.

· They can base pair with the pre-mRNA and protect it from adenylation or cleavage.

· They also form recognition point for 5’ capping point.

The proteins form a loop with intron forming a complex calle splicosome.

The exons are brought side by side. Introns is cleaved and exons are attached.

PRE M-RNA Brgnah site 1 A INTRON XO EXONS OU Splice 57 site splice site SARNAE SNRNA+ Proteins VişnRNPS bindat si Splice Seite Va SA RAIPS bindet branch Site - ( US) Sn RNP, US) SARNA Intron forms loop -SPLICEOSOME Exond and Exon 2 are near eachother s'end splicesite cut andjoined to branch site Exon a joined with Eronz EXON GYON2 s'end eplicesite cut to form laniat structure of intron with وی دارو 0