Neutral theory predicts that the highest rate of molecular evolution would be found for: A) pseudogenes, B) the third position of the codon, C) the 3’ promoter region, D) introns, E) mobile genetic elements (transposons).
Neutral theory predicts that the highest rate of molecular evolution would be found for: A) pseudogenes,...
6. (Answer this question using the neutral theory of molecular evolution) One of Charles Darwin's main ideas was that life evolves by natural selection, following a rule of "survival of the fittest." For example, if you look historically at giraffes, it is hypothesized that those with taller necks tended to be selected for evolutionarily because they could reach more food high up in trees. When we consider DNA, the same principles of natural selection apply. Those DNA regions that have...
Please solve all questions!
66. Harmless variants or their derivatives of pathogens, which stimulate the immune system are called a. transformers b) vaccines c. viral envelopes d. mutagens 67. Iniectious agents of disease consisting only of proteins: a. viroidsb. viruses c. introns prions e. transposons 68. Plasmids, transposons and viruses are all a. infectious d. 2 of the above e.none of the above mobile genetic elements c. immobile genetic elements The major component of the bacterial genome is ircular double...
real exchange rate
10. If the annu theory of PPP predicts that the euro will rate approach predicts that 0.5%, respectively, then the al percent changes of Ps. PEU and q are 5%, 1%, and in nominal terms, while the real exchange the euro will_ nominal terms. A) appreciate 4% against the dollar, appreciate 1.5% against the dollar B) depreciate 3% against the dollar; appreciate 0.5% against the dollar C) appreciate 4% against the dollar; 3.5% against the dollar D)...
1. What would happen to a gene if the stop codon (UAA, UAG, or UGA) were mitated so that the first position in the codon became a “C” (CAA, CAG, CGA)? a) the protein product of the gene would be similar than normal b) either the immature RNA transcript or the mRNA will be degraded by nonsense mediated RNA decay c) its mature messenger RNA would be lengthened d) its immature RNA would be lengthened 2. Without a promoter region,...
If a eukaryotic cell has synthesized a large quantity of a certain protein, you would know that all of the following had occurred prior to protein formation, except: A. Repressor proteins were likely bound to all of the enhancer sequences and proximal elements of the gene for this protein. B. A transcription initiation complex was formed at the promoter region of the gene for this protein. C. Chromatin remodeling occurred in the region of the chromosome containing this gene for...
TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Quiz 10 1. (2 points) Which of the following conditions would lead to the highest levels of lac operon expression? a) High lactose, high glucose b) High lactose, low glucose c) Low lactose, high glucose d) Low lactose, low glucose e) None of the above would have any lac operon expression 2. (2 points) Which of the following is true concerning molecular genetics? a) tRNA carries amino acids into the nucleus in eukaryotic cells b) DNA polymerase moves towards the...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
6. Use the kinetic molecular theory of gases to predict what would happen to a closed sample of a gas whose temperature increased while its volume decreased. A) Its pressure would decrease. B) Its pressure would increase. C) Its pressure would hold constant. D) The number of moles of the gas would decrease. E) The average kinetic energy of the molecules of the gas would decrease.