Question

QUESTION 8 Which of the following is not a stop codon UAA UAG UAU UGA 10...

QUESTION 8

Which of the following is not a stop codon

UAA

UAG

UAU

UGA

10 points   

QUESTION 9

How many chromosomes are in the genome of Dog ?

22

34

39

37

10 points   

QUESTION 10

Which of the following is the appropriate protein sequence translated from RNA sequence

AUG GAU CCG AUA AUG ACG GUC CUU AAU UGA

MetAspProIleMetThrValLeuAsn

MetAspProMetMetThrValLeuAsn

MetAspProMetMetThrValIleAsn

MetAspHisMetMetThrValIleAsn

0 0
Add a comment Improve this question Transcribed image text
Answer #1

A8) C) UAU

A9)C) 39

A10) A) MetAspProIleMetThrValLeuAsn

Feel free to leave a comment down below for any furhter query. Good rating would be appretiated if you find my answer helpful. Thank you.

Add a comment
Know the answer?
Add Answer to:
QUESTION 8 Which of the following is not a stop codon UAA UAG UAU UGA 10...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Use the genetic code table to answer the following question: Second Base First Base Third Base...

    Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...

  • The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the...

    The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...

  • B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is...

    B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...

  • Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is...

    Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...

  • you are informed that CGATCA codes for an intron UUU)phe UCU UAU TVE UUC) Pne UCC...

    you are informed that CGATCA codes for an intron UUU)phe UCU UAU TVE UUC) Pne UCC Ser UAC 'yr UUA UCA Ser UUG Leu UCG) UGUve UGC Cys UAA Stop UGA Stop UAG Stop UGG Trp CGU) CGC CCU CUU CUC CCC Pro CAC His CỦA Leu CCA CCG) CAAGI CGA Arg CUG) CAGS CGG First letter DOC DOC DOC Doco Third letter AAU Asn AGU Ser AGC Se AAA Lys AGA Arg AAG AGG/Arg AUU ACU AUC lle ACC...

  • Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note:...

    Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note: Pending the direction your DNA is located Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...

  • Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...

    Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...

  • 1. What would happen to a gene if the stop codon (UAA, UAG, or UGA) were...

    1. What would happen to a gene if the stop codon (UAA, UAG, or UGA) were mitated so that the first position in the codon became a “C” (CAA, CAG, CGA)? a) the protein product of the gene would be similar than normal b) either the immature RNA transcript or the mRNA will be degraded by nonsense mediated RNA decay c) its mature messenger RNA would be lengthened d) its immature RNA would be lengthened 2. Without a promoter region,...

  • Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...

    Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...

  • In bacteria, RF2 recognizes which of the following stop codons? UAG UAA and UAG UGA UAA...

    In bacteria, RF2 recognizes which of the following stop codons? UAG UAA and UAG UGA UAA and UGA UAA

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT