The image shows a replication fork, template DNA strands, and new DNA strands. Label the image...

Question

Question

Answer 1

Answer #1

Template strand Cold DNA strand] Leading strand (New strand)] s RNA Primer Okazaki fragments

Answer 2

Similar Homework Help Questions

In the replication fork, label the leading and lagging strands and the...

In the replication fork, label the leading and lagging strands and the 5' and 3' ends of the DNA and RNA molecules. The 5 and 3' labels are used multiple times.
2. Draw replication fork, and place and label the following -DNA being copied (template)-new D -...

2. Draw replication fork, and place and label the following -DNA being copied (template)-new D - Correct 5' and 3' markings NA-helicase -primaseleading strand and Okazaki fragments
5a. For the replication fork shown below: - label the leading and lagging strands; - draw...

5a. For the replication fork shown below: - label the leading and lagging strands; - draw arrows to indicate which direction DNA synthesis is proceeding in for each of these strands; - label their 5' and 3' ends. Replication fork movement →→→ 5'-ATCTGGCAGTACGTACTGGATC CGUCAUGC GTCGAATCTGAC-3' CAGCTTAGACTG-5' ATCTGGCTATTCGT 3'-TAGACCGATAAGCATGACCTAG b. Okazaki fragments are generated during (leading / lagging) strand synthesis (circle the correct answer). c. Some U's are included in one of the strands in the figure. Why are there U's...

The following is an image of a section of dna. if a replication fork is moving...

The following is an image of a section of dna. if a replication fork is moving from right to left, which strand (top or Bottom) is the template strand for the leading strand. 3' AAATCGCGATCGATGGTCTGAGTTTGAATC 5' 5' TTTAGCGCTAGCTACCAGACTCAAACTTAG 3'
QUESTION 3 Replication Now DNA Origin of replication DOC Replication fork B CON RO Unreplicated DNA...

QUESTION 3 Replication Now DNA Origin of replication DOC Replication fork B CON RO Unreplicated DNA Prokaryotic DNA The above diagram shows DNA replication in bacterial cells. An antibody specific only to DNA polymerase I was added to DNA undergoing replication in bacterial cells. Which of the following statements are CORRECT? a. There would be a higher concentration of antibodies on the leading strands of replication foris A and B and a lower concentration of antibodies on the lagging strands...
Formation of a replication fork results in: A. continuous synthesis of DNA on the lagging strand....

Formation of a replication fork results in: A. continuous synthesis of DNA on the lagging strand. B. supercoiling in the parental DNA ahead of the fork. C. of new 3' -OH regions on the template DNA. D. binding of SSB protein on the double-stranded parental DNA. E. All of the above occur when the replication fork is formed.

Vocabulary: DNA Replication

Vocabulary: DNA Replication A. Helicase B. Primase C. Single Strand Binding Protein (SSB) D. Topoisomerase E. Origin of Replication F. DNA Polymerase G. Leading Strand H. Lagging strand I. DNA Ligase J. Okazaki Fragment K. Replication Fork L. RNA Primer M. Topoisomerase .1. Site where the replication of a DNA molecule begins. 2. The new continuous complementary DNA strand synthesized in the direction for the replication fork. 3. A discontinuously synthesized DNA strand that elongates in a direction away from the replication fork 4. Relaxes...
SO MMD WON Parental strands Daughter strands 2) Considering the DNA replication fork shown above, with...

SO MMD WON Parental strands Daughter strands 2) Considering the DNA replication fork shown above, with the 5' end of one daughter strand marked, what end of DNA (5' or 3') should occur on the parental strand at the position marked with an 'X'? a) 5' b) 3 c) Either 5' or 3', both are equally possible d) Impossible to determine with the information given
What figure correctly depicts the direction of replication of the leading and lagging strands at replication...

What figure correctly depicts the direction of replication of the leading and lagging strands at replication fork? (All lines with arrows show the newly synthesized DNA and indicate the direction of polymerization. The 5' and 3 designations are indicated on the template DNA.) A) A B) B C) C D) D E) E

Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands...

Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...