Question

You are presented with a 14-year-old patient suffering from Hereditary Infantile Drooling Disorder (HIDD), and insidious disease in which children appear normal until age 14, at which time they begin to drool uncontrollably. Little is known about the genetics of HIDD, so you decide to do a study. You obtain a sample of DNA from the patient and a normal volunteer, and sequence the HIDD gene. The sequences are shown below:

Key: Blue = C; Red = T; Green = A; Yellow =G

Enzyme list:

Eco RI: 5’-GAATTC-3’

Hind III: 5’-AAGCTT-3’

Pvu II: 5’-CAGCTG-3’

Xho I: 5’-CTCGAG-3’

Sal I: 5’-CTGCAG-3’

A) Determine the sequence of the WT allele (be sure to read from bottom up) and write it out. There are several mutations present in the HIDD allele – list these, and (after consulting the list of available restriction endonucleases) indicate which mutant sequence could be used to do RFLP analysis. Be sure to mention which enzyme you would have to use.

The sequences I got....

WT Allele

AGCTATCTAATGGGCGAACTCTAGGGACTTGCAAGGCTATTTCCCATAGT

HIDD

AGCTCTCTAATGGGCGAACTCGAGGGACTTGCAAGGCTATTGCCCATAGT

Xho I

I was told this (however, I'm not sure if it's correct... I'm not understanding the mutant sequences portion, I'm confused by where the "mutant sequences" GAGCTCT and TGCCCAT come from?..)

"The sequence of WT and HIDD alleles are correct. The mutant sequences are GAGCTCT, TGCCCAT. The enzyme XhoI can be used to cut the sequence at position 19. Of the two mutant sequences, GAGCTCT sequence is used where A in WT is replaced by C in HIDD and produces recognition sequence. Hence this enzyme cannot cut the WT sequence."

Answer 1

As you said the, the sequence from 19th nucleotide onwards in case of HIDD is different and is CTCGAG and if you want to cleave only HIDD gene leaving the WT allele, then you must slect the Xho I restriction enzyme. This will be useful to perform the RFLP analysis.