Question

Identify two restriction endonucleases that could be used to make sticky ends near the 5’ end of this DNA sequence (upper strand) so that it could be incorporated into a new plasmid. You have a short list of them in Table 9-2, and the specific, short sequences of bases that other enzymes cut at are easily obtained from web resources. You must cut as near to the 5' end as possible. Indicate the specific sequences of bases for each endonuclease using highlighting or underlining, and name the specific endonucleases. Note that we would normally want endonucleases to cut at both ends, but if you can answer this question I am confident you can also find an endonuclease for the 3' end (although this is not part of the question).

6.You have identified a sequence of bases that corresponds to the regulatory protein for glycogen phosphorylase. Here is part of that dsDNA sequence: 1 5'-TTGGAGTCGGATCCTTACTGCAGAATTTGCTTACGCGCTATTACTCGTTA 3-AACCTCAGCCTAGGAATGACGTCTTAAACGAATGCGCGATAATGAGCAAT 51 AAGGCTATCTACGATCAAATTTCCGATAGCTAGACCTTAGCTACTAGATC TTCCGATAGATGCTAGTTTAAAGGCTATCGATCTGGAATCGATGATCTAG 101 GGCGATAGCTAGATCGCGCGATAGCGATAGCTAGACTCCCTTAGAAATC CCGCTATCGATCTAGCGCGCTATCGCTATCGATCTGAGGGAATCTTTAG 151 TACTAGCTAGGCATCCTAGCTAGATCCCTAGAAGCTAGGGCTAGTGTGC ATGATCGATCCCTAGGATCGATCTAGGGATCTTCGATCCCGATCACACG 201AGAACACAGTAGCTCCGGATAGCTAGATCGGCGCGATAAATTATAGATC TCTTGTGTCATCGAGGCCTATCGATCTAGCCGCGCTATTTAATATCTAC 251GATAGTAGCCGTAAAGCTCGCGCGACGATAAGCTTCTAATCGATTTACG-3 CTATCATCGGCATTTCGAGCGCGCTGCTATTCGAAGATTAGCTAAATGC-5' DNA about 25 bp from the recognition sequence. Bot types move along the DNA in a reaction that requires duced by cleaving genomic DNA with TABLE 9-2 Recognition Sequences for Some Type lI Restriction Endonucleases (5') AAGCTT8 TTCGAA HindIII (5') GGATCC (8') CCTAGG BamHI (5) GCGGCCGC) CGCCGGCG NotI (5) ATCGAT (3') TAGCT A Clal er pa thi le (5) CTGCAG(3) GACGT C PstI EcoRI (5) GAATTC (8') CTTAAG all re EcoRV (5) GATATC (3') CTATA G Pvull (5) CAGCTG@) GTCGAC th HaelII (5) GACNNNGC CTGNNNCAG Tthll1I CCG G Note: Arrows indicate the phosphodiester bonds cleaved by each restriction endonuclease. Asterisks indicate bases that are methylated by the corresponding methy N denotes any base. Note that the name of each enzyme consists of a three-letter abbreviation of the bacterial species from which it is derived, sometimes followed by a and roman numerals to distinguish different restriction endonucleases isolated from the same bacterial species. Thus BamHl is the first (1) restriction endonuclease c Bacillus amgloliquefaciens, strain H.

Answer 1

From the list of restriction enzymes given in the provided table, EcoR V, PvuII, HaeII and Tth 1111 could not be use to digest the given DNA fragment as sticky end is required

BamHI and PstI are the two appropriate enzymes that could be use to digest the given DNA.

BamHI will cut the DNA very near to the 5' end. The position for restriction sites of BamHI are shown in the given image. The recognition sequence for BamHI is highlighted with red whereas the cutting site is indicated by the arrow.

Similarly, recognition sites for Pst 1 is highlighted in green and the cutting site is indicated by arrow (Below image)

The BamHI will cut the DNA at base position 9 whereas PstI will cut at base position 22.

STIGGAGICOLEATCCTACTOCALAATOCTA 3'AACCTCAGCCTAGGAATGACGTCTTAAACGAAT