For the next part of the assignment, you need to take the appropriate sequence below (based on the first letter of your last name), and use the nucleotide BLAST function on GenBank () to identify A) What gene was amplified B) From what organism the sequence came (scientific and common name), and C) in which Order that species is taxonomically placed
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch
CTGTGACTTTGCCAAGTGGAGGTGTGTGCTGAAGATCTCAGACAGCTGCCCCACACCTCTTGCCATCGCAGAGAATGCCAACGTACTGGCCAGATATGCCAGCATTTGTCAACAGGTTGGCATCACCCACTCAATAGAAATGACACCCAATTTGCAAGTACTACAATGGCACTCAGTGAAATTTGAACAATGCTAATATGAATCAGCAGC
The gene amplified has following details
A)Phycodurus eques isolate eques1D aldolase-like protein gene, partial cds (coding sequence)
GenBank accession number KM201579.1
B) Phycodurus eques (leafy seadragon) - Source
C) Eukaryota; Metazoa; Chordata; craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Syngnathiaria; Syngnathiformes; Syngnathoidei; Syngnathidae; Phycodurus
For the next part of the assignment, you need to take the appropriate sequence below (based...
x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...
Once a bacterial 16s rRNA gene has been amplified, it is possible to have the nucleotide sequence of the DNA determined. There are many different techniques for this. In lab, you isolated and amplified DNA from a known organism (Escherichia coli), but what if you had to identify an unknown organism? You would send the sample away for sequencing and then once you got the results you would “BLAST” the sequence. Using the Standard Nucleotide BLAST on NCBI and the...
please answer questions with the following BLAST results For your GenBank assignment due at 12 noon on Thursday May 23rd (don't forget, I will not accept late papers): 1. Dr. Monsen-Collar will tell you the number of a sequence posted on Canvas. Copy the entire sequence and use it in a BLAST search to determine what gene the sequence is. Answer the following questions: A. What gene is your unknown sequence likely to be? How do you know it's a...
x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...
Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an mRNA that can be translated. The gene organization is the order of the DNA segments that comprise the gene starting with the promoter, the first exon, the first intron, the second exon, and so on. The interspersed intrans can make gene identification difficult in eukaryotesparticularly in higher eukaryotes with many introns and alternative spliced mRNAs. Prediction of many genes and their organization has been...
PYTHON INTRODUCTION: Over the next weeks, you will be developing a small software project that includes a wide range of activities: needs analysis, screen design, algorithm development, programming, testing, debugging, documentation and publishing. PRELIMINARY: The last part of the lab assignment is to complete the design of the DroneDogs Order Form below by entering names for the controls on the screen form, using Hungarian Notation (sometimes called modified Hungarian Notation) as the naming convention for variables and controls. Hungarian notation...
Roadmap To start, use the provided template file (on Blackboard): project_01_template.py. Replace the pass statements with your code. Notice that we included test cases under every function. If you run the project_01_template.py file at this point it should print False for each test. After you write the correct code for each function, and then run the file, it should print True for each test. 1. Write a function named gc_content that takes one argument sed and performs the following tasks:...
A cell's genome is its blueprint for life. However, what is the bare minimum number of genes needed to sustain a free-living cell? This is a question that microbiologists at the J. Craig Venter Institute (JCVI) have attempted to answer ever since they sequenced the genomes of several Mycoplasma species in the 1990s. Because Mycoplasma species are parasitic bacteria, their genomes are already reduced in size and hence provide an excellent foundation for creating a "minimal cell." However, little did...
In this assignment, you will explore more on text analysis and an elementary version of sentiment analysis. Sentiment analysis is the process of using a computer program to identify and categorise opinions in a piece of text in order to determine the writer’s attitude towards a particular topic (e.g., news, product, service etc.). The sentiment can be expressed as positive, negative or neutral. Create a Python file called a5.py that will perform text analysis on some text files. You can...
What genes (or kind of genes) will you focus on in your investigative research? Provide 2-3 reasons for your choice of these gene/s. Starting with the bone sample itself, what methods will you use to get DNA that you can sequence? Which “ingredients” in your lab reactions will determine which gene or genes are copied? How is it that these ingredients are able to target a specific gene? What method will you use to see if your efforts to copy...