Suspect 2 has mostly commited the crime.
We can see that clearly from crime scene 2 , the DNA isolated is similar to that of victim and that obtained from crime scene 1 is same as that of suspect 2.
In your opinion, what is the earliest computer crime ever committed?
Forensics/genetics help! Thanks! 1) In the gel pictured below, lane 1 is from a crime scene, the other lanes are from suspects. a. Which is the only suspect that is not excluded from the crime? b. If all alleles possible for that locus are represented, what is the probability that the non-excluded suspect matches the crime scene sample by chance? Explain the banding pattern for the individual in lane 7. 3 6 c. |-- (A 2pts, b 4pts, c 4pts)...
Every week there is a crime committed either locally, regionally, or nationally. As described in Chapter 12, insanity is a legal term that determines a person's competency in standing trial for a crime they have committed. Do you think we use mental illness as a justification for criminal activity, or is it not used enough? Your initial post should be at least 100 words in length.
Question 5 The size of a piece of DNA can determine how fast or slow it travels during gel electrophoresis. True False Question 6 Radioactive probes attach to the complimentary base during some DNA lab processes. For instance a C would attach to a G and a T would attach to an A (nucleic acids). True False Question 7 How could/might all of this type of information at some point in time impact you personally (or your family members)? (Consider...
The next gel is from a crime scene (CS). There are four suspects (A, B, C, and D). DNA samples and four suspects were obtained from the crime scene. You can predict which of these is guilty of the crime. Explain your answer and why the other suspects are not to blame. A B D BXP007 alleles Wave 21||||||| AL: Allele ladder CS: Crime Scene A: Suspect A B: Suspect B C: Suspect D: Suspect D 5-2 74 5-2 7-2...
Question 6 A 10% polyacrylamide gel has pores than a 12% polyacrylamide gel, so proteins migrate smaller; slower bigger; faster bigger, slower smaller faster
26.5+ 1.589 26.5+ 1.710 Question 5 10 pts The U.S. Commission on Crime randomly selects 600 files of recently committed crimes in an area and finds 380 in which a firearm was reportedly used. Find a 95% confidence interval for p, the true fraction of crimes in the area in which some type of firearm was reportedly used. Upload Choose a File 10 pts Question 6
D Question 34 1 pts Figure 4: CTAGGAATTCAGAGCTGAATTCGGCGAATTCAA GATCCTTAAGTCTCGACTTAAGCCGCTTAAGTT A crime lab uses the restriction enzyme Eco-RI (G/AATTC) on a crime scene DNA sample. From the sequence shown (Fig. 4), how many molecule clumps should show up on the electrophoresis gel? four it will vary every time one two six
Question 16 (6 points) The number of police officers, X, and the number of murders committed in 2015 in US cities, y are related by the regression line equation y = 0.786 +0.032x. According to the model, how many murders were committed in 2015 in a city with x = 318 police officers? Round your answer to the nearest whole number.
A study is done of people who have been charged by police on a drug-related crime in a large urban arca. A conviction must take place in order for there to be a sentence of jail time The following information is determined: 75% are convicted. 10% of those convicted actually did not commit the crime. 25% ofthose not convicted actually did commit the crime. 2% of those who actually did not commit the crime are jailed. 20% of those who...