Homework Answers
Answer. Six
Restriction sites are marked with pink colour as seen in the attached image :
Add Answer to:
D Question 34 1 pts Figure 4: CTAGGAATTCAGAGCTGAATTCGGCGAATTCAA GATCCTTAAGTCTCGACTTAAGCCGCTTAAGTT A crime lab uses the restriction enzyme...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this...
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...
3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if...
3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if the cytosines in this sequence have been methylated. NotI will not cleave the DNA at this site. For this reason, Net is commonly used to investigate the methylation state of CpG islands. A researcher has studied a gene, which we will call T. that is found in com, and encodes a transporter involved in the uptake of phosphate from the soil. A CpG island...
on the me but not with the larger fragments on o t and more and record...
on the me but not with the larger fragments on o t and more and record med in the h 3. Determine the distracted for each bund data bere 4. Determine the distance traveled for each and generated in the double digest and record data bere tion Endonuclease Digestion and Gel Electrophoresis of DNA 185 VI. RESTRICTION MAPPING The different DNA fragments generated by different map DNA. For example, specific DNA on 2000 nucleotides in las Rl or Hind and...
L= No restriction B=Bam HI E=EcoRI H=Hind III Band 1 27mm 31mm 29mm 29mm Band 2...
L= No restriction
B=Bam HI
E=EcoRI
H=Hind III
Band 1
27mm
31mm
29mm
29mm
Band 2
NA
34mm
41mm
37mm
Band 3
NA
41mm
46mm
43mm
Band 4
NA
43mm
49mm
52mm
Band 5
NA
46mm
57mm
71mm
Band 6
NA
NA
NA
76mm
Above is the actual measurements for the distance in mm. Please
plug this in with the existing chart located above
Gel Electrophoresis lab assignment The following sheets will be used to demonstrate your knowledge of gel...
D Question 1 1 pts Questions 1 through 8 all refer to the sample data and figure described here Because questions build...
D Question 1 1 pts Questions 1 through 8 all refer to the sample data and figure described here Because questions build on the results of preceding questions, you are encouraged to write out your calculations and results as you work through this assignment You assay 1000 diploid fruit flies for allelic and genotypic variation at the enzyme locus alcohol dehydrogenase (ADH)The assay consists of extracting protein from each fly and running it on anelectrophoreticgel. Some al ozymes proteln products...
help with questions 5 to 10 please PCB 3023L Lab #4 Protocol & Worksheet (30pt) You...
help with questions 5 to 10 please
PCB 3023L Lab #4 Protocol & Worksheet (30pt) You may work in your lab groups durine class. but all written answers must be completed individually in your own words. 1) Using the plasmid map for orientation 1 and the cDNA map as a guide, complete the plasmid map for orientation #2. (4pt) 612 1318 1 - EcoRi EcoRI Xbal ECORV -Xbal- 1662 +Bell EcoRI EcoRV Not FP -- Xhol X 2015 PRSP +...
Please need help answering question A the pages of background information are posted thanks Read page...
Please need help answering question A the pages of background
information are posted thanks
Read page 196-197 and figure 6.20. regarding Meselson and
Stahl’s experiment regarding DNA replication. And Answer the
following question
If you are using this radioactive technique in mouse cells,
what would happen in each phase of G1, S, G2, mitosis and meiosis
assuming that you are grown cells in 15N medium for many
generations and cells in G1are then switched to 14N medium?
G1
S
G2...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...
3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if the cytosines in this sequence have been methylated. NotI will not cleave the DNA at this site. For this reason, Net is commonly used to investigate the methylation state of CpG islands. A researcher has studied a gene, which we will call T. that is found in com, and encodes a transporter involved in the uptake of phosphate from the soil. A CpG island...
on the me but not with the larger fragments on o t and more and record med in the h 3. Determine the distracted for each bund data bere 4. Determine the distance traveled for each and generated in the double digest and record data bere tion Endonuclease Digestion and Gel Electrophoresis of DNA 185 VI. RESTRICTION MAPPING The different DNA fragments generated by different map DNA. For example, specific DNA on 2000 nucleotides in las Rl or Hind and...
L= No restriction
B=Bam HI
E=EcoRI
H=Hind III
Band 1
27mm
31mm
29mm
29mm
Band 2
NA
34mm
41mm
37mm
Band 3
NA
41mm
46mm
43mm
Band 4
NA
43mm
49mm
52mm
Band 5
NA
46mm
57mm
71mm
Band 6
NA
NA
NA
76mm
Above is the actual measurements for the distance in mm. Please
plug this in with the existing chart located above
Gel Electrophoresis lab assignment The following sheets will be used to demonstrate your knowledge of gel...
D Question 1 1 pts Questions 1 through 8 all refer to the sample data and figure described here Because questions build on the results of preceding questions, you are encouraged to write out your calculations and results as you work through this assignment You assay 1000 diploid fruit flies for allelic and genotypic variation at the enzyme locus alcohol dehydrogenase (ADH)The assay consists of extracting protein from each fly and running it on anelectrophoreticgel. Some al ozymes proteln products...
help with questions 5 to 10 please
PCB 3023L Lab #4 Protocol & Worksheet (30pt) You may work in your lab groups durine class. but all written answers must be completed individually in your own words. 1) Using the plasmid map for orientation 1 and the cDNA map as a guide, complete the plasmid map for orientation #2. (4pt) 612 1318 1 - EcoRi EcoRI Xbal ECORV -Xbal- 1662 +Bell EcoRI EcoRV Not FP -- Xhol X 2015 PRSP +...
Please need help answering question A the pages of background
information are posted thanks
Read page 196-197 and figure 6.20. regarding Meselson and
Stahl’s experiment regarding DNA replication. And Answer the
following question
If you are using this radioactive technique in mouse cells,
what would happen in each phase of G1, S, G2, mitosis and meiosis
assuming that you are grown cells in 15N medium for many
generations and cells in G1are then switched to 14N medium?
G1
S
G2...
Most questions answered within 3 hours.
-
True or False?
Considering a door as a rigid body. Its angular motion happens
in a...
asked 2 minutes from now -
In
IUPAC naming, do we concider the prefix in alphabatizing?
In other words do we look...
asked 2 minutes ago -
If a trust has income required to be distributed of $11,500,
other amounts paid or required...
asked 19 minutes ago -
The degree of ionization of a weak acid
____________________.
Select all that are True.
a) varies...
asked 19 minutes ago -
Cereal for Breakfast. A cereal company claims
70% of Americans start the day with cereal for...
asked 19 minutes ago -
An elevator has a placard stating that the maximum capacity is
2400 lblong dash15 passengers. So,...
asked 22 minutes ago -
two charged proteins P1 and P2 are located at the positions
(1m,1m) and (-1m,1m) respectively on...
asked 33 minutes ago -
eBook
Calculator
Job Order Cost Sheet
Remnant Carpet Company sells and installs commercial carpeting
for office...
asked 38 minutes ago -
Using Kapustinskii equation, determine the lattice energy of a
hypothetical compound NaCl2 . Assume the sum...
asked 40 minutes ago -
Most schools and
businesses require some standard style of documentation for written
reports. Discuss why might...
asked 37 minutes ago -
cookbooks are going metric. in such books 1 cup is equal to 240
ml. Express 1...
asked 40 minutes ago -
________40. Which of the following is the correct sequence of
steps in the general
adaptation...
asked 49 minutes ago