Homework Answers
Request Answer!
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
Add Answer to:
on the me but not with the larger fragments on o t and more and record...
can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel be...
can
someone explain throughly on how to find a-c??? thanks!!!
The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
Hi I have a problem with number 5, it involves gel analysis results. There are 2 parts, a,b,c. For A Im sure you need to make a graph with distance in (cm) on the vertical axis and log10 bp on the hor...
Hi I have a problem with number 5, it involves gel
analysis results. There are 2 parts, a,b,c. For A Im sure you need
to make a graph with distance in (cm) on the vertical axis and
log10 bp on the horitzontal. I need help figuring out where to
start and what to do. Please help!
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...
Hi can someone help me understand part C and why the drawn in red lines are...
Hi can someone help me understand part C and why the
drawn in red lines are where they are.
Basically from the bp given how can I go back to cm so I can
drawn them into the picture provided?
Do not need help with A or B.
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes...
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Use the following depiction of a gel of Hind III fragments to answer the questions: 1...
Use the following depiction of a gel of Hind III fragments to answer the questions: 1 Kb Ladder Possible Hind III Fragments: 1 Kb Ladder Sizes 10,000 8,000 564 bp 8,888 2.0 kb 2.3 kb 11 4.36 kb 4,000 3,000 2,500 2,000 1,500 6.5 kb 9.4 kb 23 kb 1,000 750 500 250 1. Based on the gel results, list the sizes of the chromosome fragments cloned: 2. Based on the gel results, list the sizes of the chromosome fragments...
Suppose you are going to do a restriction digest with a plasmid, using the restriction enzyme...
Suppose you are going to do a restriction digest with a plasmid, using the restriction enzyme Eco R1. A map of the plasmid is shown here. The entire plasmid is 6000 bp, and there are Eco R1 restriction sites at 1500 bp, 2000 bp, and 4000 bp. You’re going to run the entire volume of the digest on a gel, and you want to cut just enough DNA to have 50 ng in the smallest band on your gel. Starting...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
1. You perform a restriction endonuclease assay on an uncharacterized DNA molecule, using Pstl, Sall, and...
1. You perform a restriction endonuclease assay on an uncharacterized DNA molecule, using Pstl, Sall, and Xhol. When you run the DNA on a 1% agarose gel, you obtain the following information regarding fragment number and length (all lengths are in bp): Pstl (P) 700 200 Sall(s) 600 300 Xhol (X) 500 350 50 Pstl + Sall (P+S) 600 200 100 Pstl + Xhol (P+X) 500 200 150 50 Sall + Xhol (S+X) 500 250 100 50 Solve the following...
can
someone explain throughly on how to find a-c??? thanks!!!
The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
Hi I have a problem with number 5, it involves gel
analysis results. There are 2 parts, a,b,c. For A Im sure you need
to make a graph with distance in (cm) on the vertical axis and
log10 bp on the horitzontal. I need help figuring out where to
start and what to do. Please help!
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...
Hi can someone help me understand part C and why the
drawn in red lines are where they are.
Basically from the bp given how can I go back to cm so I can
drawn them into the picture provided?
Do not need help with A or B.
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Use the following depiction of a gel of Hind III fragments to answer the questions: 1 Kb Ladder Possible Hind III Fragments: 1 Kb Ladder Sizes 10,000 8,000 564 bp 8,888 2.0 kb 2.3 kb 11 4.36 kb 4,000 3,000 2,500 2,000 1,500 6.5 kb 9.4 kb 23 kb 1,000 750 500 250 1. Based on the gel results, list the sizes of the chromosome fragments cloned: 2. Based on the gel results, list the sizes of the chromosome fragments...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
1. You perform a restriction endonuclease assay on an uncharacterized DNA molecule, using Pstl, Sall, and Xhol. When you run the DNA on a 1% agarose gel, you obtain the following information regarding fragment number and length (all lengths are in bp): Pstl (P) 700 200 Sall(s) 600 300 Xhol (X) 500 350 50 Pstl + Sall (P+S) 600 200 100 Pstl + Xhol (P+X) 500 200 150 50 Sall + Xhol (S+X) 500 250 100 50 Solve the following...
Most questions answered within 3 hours.
-
Write a program to solve the Josephus problem, with the following
modification:
Sample Input:
./a.out n...
asked 11 minutes ago -
At the start of a CD it is spinning at a rate of 525 rpm
(revolutions...
asked 47 minutes ago -
4. Without doing any calculations, predict whether the observed
∆T would increase, decrease or remain the...
asked 2 hours ago -
Based on the range, which of the following sets of scores has
the greatest variability? 3,...
asked 3 hours ago -
Ripples in a pond travel at a velocity of 3 m/s with one peak
passing a...
asked 2 hours ago -
A man stands on the roof of a building of height 13.0 mm and
throws a...
asked 3 hours ago -
The extent to which assets are financed by borrowed funds and
other liabilities is indicated by:...
asked 4 hours ago -
Explain in detail
Germany is the fifth largest economy
explain what goods and services Germany specializes...
asked 4 hours ago -
The density of platinum is 21.45 g/mL. If a cube of platinum
with a mass of...
asked 4 hours ago -
Accounts Receivable
Sales
A/R Posting
Extended Sales Invoice
Packing Slip
Compare invoice to packing slip 2...
asked 4 hours ago -
Michaella, age 23, is a full-time law student and is claimed by
her parents as a...
asked 4 hours ago -
Why are polymers not typically casted into products?
asked 4 hours ago