Homework Answers
The DNA strand sequence is TACCGAGTCACG. The mRNA molecule is complementary to the DNA molecule and the sequence is ATGGCTCAGTGC. However, in the mRNA molecule, Thymine is replaced by Uracil. Therefore, the mRNA strand would read AUGGCUCAGUGC.
The second amino acid produced by the DNA strand (or mRNA strand) is encoded for the second triplet codon. Here, the first triplet codon is in the DNA molecule is TAC (AUG in the mRNA) and the second triplet codon is CGA (GCU in the mRNA). By looking up GCU in the table, we see that the codon GCU codes for Alanine. Therefore, the second amino acid produced by the DNA molecule is Alanine.
The third codon of the DNA molecule is GTC, which is transcribed to CAG in the mRNA. looking up in the RNA codon table, we see that CAG codes for Glutamine. Therefore, Glutamine is the third amino acid produced by the DNA strand.
In the Codon table, GAU and GAC code for Aspartate. These are complementary to the DNA codon. Therefore, the DNA codons that code for Aspartate are CTA and CTG (pick one).
Add Answer to:
please help !
What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG? Check...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA...
7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA is transcribed from the complementary strand (not shown) to this DNA. What will be the sequence of the pre-mRNA (make sure you label the 5' and 3'ends)? BUCO BUCO DUCO DUCO B. The lowercase letters in the sequence above represent an intron. Starting at the ATG, what would be the protein sequence once the intron is properly removed? с Two mutations occurred. 1) A...
A strand of DNA has the base sequence GATTCA
3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’
One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’ (a) Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? (b) What is the amino acid sequence of the proteins. (c) Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not. (d) If the T underlined in the above sequence was to...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
Answer please? The sequence below represents a middle section of the template strand of DNA of...
Answer please?
The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3 CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5' What would be the immature RNA...
help me answer these- One strand of a section of DNA Isolated from the bacterium E....
help me answer these-
One strand of a section of DNA Isolated from the bacterium E. cow reads: answer all parts 5- GTAAGCTACGGATAGG -3 A. Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template meaning this is the coding strand). What will be the sequence of the mRNA in this region (make sure you label the 5 and 3' ends of the mRNA)? B. How many different peptides could potentially be made from...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1)...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA is transcribed from the complementary strand (not shown) to this DNA. What will be the sequence of the pre-mRNA (make sure you label the 5' and 3'ends)? BUCO BUCO DUCO DUCO B. The lowercase letters in the sequence above represent an intron. Starting at the ATG, what would be the protein sequence once the intron is properly removed? с Two mutations occurred. 1) A...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
Answer please?
The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3 CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5' What would be the immature RNA...
help me answer these-
One strand of a section of DNA Isolated from the bacterium E. cow reads: answer all parts 5- GTAAGCTACGGATAGG -3 A. Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template meaning this is the coding strand). What will be the sequence of the mRNA in this region (make sure you label the 5 and 3' ends of the mRNA)? B. How many different peptides could potentially be made from...
Most questions answered within 3 hours.
-
Imagine that a chemist puts 6.40 mol each of
C3H8 and O2 in a 1.00-L container...
asked 9 minutes ago -
How much money should be invested today in order to have $8340
at the end of...
asked 13 minutes ago -
You are conducting research for a hospital and issue a survey to
patients.
Based on the...
asked 14 minutes ago -
What might be a negative mutation that would hinder the
bug population?
asked 23 minutes ago -
A company just paid a dividend of $1.50 per share. The consensus
forecast of financial analysts...
asked 19 minutes ago -
A mass of 0.50 g of an unknown acid HA required 20.0 mL of 0.25
M...
asked 29 minutes ago -
Mitch is a director and officer of Numero Uno, Inc. Mitch makes
a marketing decision that...
asked 30 minutes ago -
A pair of fair dice is tossed. Let X denote the larger of the
two numbers...
asked 38 minutes ago -
What are the variety of forms of products dispensed with aerosol
spray?
asked 42 minutes ago -
Which one of the following statements is true about C++
keywords?
a. A keyword can have...
asked 42 minutes ago -
Pyruvate Kinase, an allosteric enzyme, accelerates the
conversion of phosphoenolpyruvate to pyruvate.
1) Draw curves describing...
asked 44 minutes ago -
question 1
Which of the following is an example of a bottom-up technique
for developing promotional...
asked 1 hour ago