Homework Answers
Add Answer to:
Draw and label the intron splicing mechanism and steps for the splicing of one intron from...
3. Draw the chemical mechanism (with electron-pushing arrows) for the first step of RNA splicing (as...
3. Draw the chemical mechanism (with electron-pushing arrows) for the first step of RNA splicing (as catalyzed by the splicosome). Be sure to explicitly show the attacking nucleophile, the phosphate at the intron-exon junction, the intron branch point and the leaving group in the reaction.
on and 6. Draw the same Eukaryotic transcript after splicing has removed the m label the...
on and 6. Draw the same Eukaryotic transcript after splicing has removed the m label the remaining parts. 7. Describe the roles of the following features involved in Eukaryotic transcription: TATA Binding Protein General Transcription Factors Polymerase II 8. In Eukaryotic transcription, which happens first? A. The General Transcription Factors are recruited, and the Preinitiation complex (PIC) is assembled. B. The TBP binds the promoter 9. Describe the carboxy terminal domain (CTD) of RNA polymerase II and two of its...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...
Draw the mechanism for the reaction shown below: o This mechanism requires 6 distinct steps This...
Draw the mechanism for the reaction shown below: o This mechanism requires 6 distinct steps This is an acid-catalyzed reaction, use the H30+ in your mechanism o Be sure to include all curved arrows to show the movement of electrons Be sure to include all lone pairs and formal charges on atoms, as necessary For each step in your mechanism, label it based on the type of mechanism step it is H H :N-H
Choose two (2) of the mechanisms of gene expression regulation in eukaryotic cells denoted by rows...
Choose two (2) of the mechanisms of gene expression regulation in eukaryotic cells denoted by rows shown (7 possible in the Figure below. I will only grade your first to for completeness and will NOT grade any more that you write. If you do an EXTRAODINARY job on your answers, you may ear bonus points For each of your choices answer the following 4 questions using COMPLETE sentences 1. What are the base structural differences between molecules (pink, blue or...
One of the steps in the mechanism of the above reaction is shown below. Draw the...
One of the steps in the mechanism of the above reaction is shown below. Draw the structure of all of the products of this reaction. You do not have to consider stereochemistry. Draw enolate anions in their carbanion form. You should include all products. Include counter-ions, e.g., Na^+, I^-, in your submission, but draw them in their own separate sketcher. Draw one structure per sketcher. Add additional sketchers using the drop-down menu in the bottom right corner. Separate multiple products...
Making sure to show all steps and arrows, draw a plausible mechanism from the transformation shown...
Making sure to show all steps and arrows, draw a plausible
mechanism from the transformation shown below.
1) Making sure to show all steps and arrows, draw a plausible mechanism for the transformation shown below. (10 points) ОН - &- + HBr Br
Below is a series of events involved in the mechanism of forming a retrotransposon. Place these...
Below is a series of events involved in the mechanism of forming a retrotransposon. Place these steps in the correct order 1. the DNA copy is made double-stranded 2. DNA of the transposable element is transcribed 3. The DNA of the transposable element is integrated into a target DNA site 4. The RNA is reverse transcribed by reverse transcriptase, producing a complementary DNA 4,2,3,1 3,2,4,1 2,4,1,3 4,2,1,3 1,2,3,4 What is the function of the poly(A) tail on most mRNAs To...
CH3 7) Draw in the appropriate curly arrows for the following El mechanism. Note! The below...
CH3 7) Draw in the appropriate curly arrows for the following El mechanism. Note! The below steps are the steps in a single mechanism for a single reaction! Pay attention to lone pairs (i.e. draw them in if appropriate.) Also write in hidden hydrogens that are in the vicinity of the reaction site. HO Start by rewriting each of the reactants. Then use "arrow pushing" to show how the reactants are converted to products, assuming an El mechanism. Be sure...
Which of the following strategies are used by some microbes to evade complement” Interfere with complement...
Which of the following strategies are used by some microbes to evade complement” Interfere with complement activation by the classical pathway Produce proteins that bind and inactivate complement proteins Produce proteases that destroy complement proteins Produce proteins that mimic or bind complement regulatory proteins All of the above are correct. With respect to the T cell receptor, TCR: One gene encodes the ɑ subunit, a different gene encodes the ? subunit Four genes are involved encoding both αβ and ϒδ...
3. Draw the chemical mechanism (with electron-pushing arrows) for the first step of RNA splicing (as catalyzed by the splicosome). Be sure to explicitly show the attacking nucleophile, the phosphate at the intron-exon junction, the intron branch point and the leaving group in the reaction.
on and 6. Draw the same Eukaryotic transcript after splicing has removed the m label the remaining parts. 7. Describe the roles of the following features involved in Eukaryotic transcription: TATA Binding Protein General Transcription Factors Polymerase II 8. In Eukaryotic transcription, which happens first? A. The General Transcription Factors are recruited, and the Preinitiation complex (PIC) is assembled. B. The TBP binds the promoter 9. Describe the carboxy terminal domain (CTD) of RNA polymerase II and two of its...
Draw the mechanism for the reaction shown below: o This mechanism requires 6 distinct steps This is an acid-catalyzed reaction, use the H30+ in your mechanism o Be sure to include all curved arrows to show the movement of electrons Be sure to include all lone pairs and formal charges on atoms, as necessary For each step in your mechanism, label it based on the type of mechanism step it is H H :N-H
Choose two (2) of the mechanisms of gene expression regulation in eukaryotic cells denoted by rows shown (7 possible in the Figure below. I will only grade your first to for completeness and will NOT grade any more that you write. If you do an EXTRAODINARY job on your answers, you may ear bonus points For each of your choices answer the following 4 questions using COMPLETE sentences 1. What are the base structural differences between molecules (pink, blue or...
One of the steps in the mechanism of the above reaction is shown below. Draw the structure of all of the products of this reaction. You do not have to consider stereochemistry. Draw enolate anions in their carbanion form. You should include all products. Include counter-ions, e.g., Na^+, I^-, in your submission, but draw them in their own separate sketcher. Draw one structure per sketcher. Add additional sketchers using the drop-down menu in the bottom right corner. Separate multiple products...
Making sure to show all steps and arrows, draw a plausible
mechanism from the transformation shown below.
1) Making sure to show all steps and arrows, draw a plausible mechanism for the transformation shown below. (10 points) ОН - &- + HBr Br
Below is a series of events involved in the mechanism of forming a retrotransposon. Place these steps in the correct order 1. the DNA copy is made double-stranded 2. DNA of the transposable element is transcribed 3. The DNA of the transposable element is integrated into a target DNA site 4. The RNA is reverse transcribed by reverse transcriptase, producing a complementary DNA 4,2,3,1 3,2,4,1 2,4,1,3 4,2,1,3 1,2,3,4 What is the function of the poly(A) tail on most mRNAs To...
CH3 7) Draw in the appropriate curly arrows for the following El mechanism. Note! The below steps are the steps in a single mechanism for a single reaction! Pay attention to lone pairs (i.e. draw them in if appropriate.) Also write in hidden hydrogens that are in the vicinity of the reaction site. HO Start by rewriting each of the reactants. Then use "arrow pushing" to show how the reactants are converted to products, assuming an El mechanism. Be sure...
Most questions answered within 3 hours.
-
Trace the following recursive methods:
a) isPal with the string “abccda”
b) isAnBn with the string...
asked 51 minutes ago -
1. Which of the following is false about photosynthesis?
A. ATP is the molecule used to...
asked 1 hour ago -
A simple random sample of size n=64 is obtained from a
population with a mean of...
asked 2 hours ago -
(2 dimensions, 1 object, 2 accelerations)
1) A projectile is thrown with a wind. The wind...
asked 3 hours ago -
Brian makes $34,100 per year. How much can Brian expect to
contribute to FICA taxes in...
asked 4 hours ago -
To buy a new house you must borrow $155,000. To do this you take
out a...
asked 4 hours ago -
Spacely Sprockets is evaluating the construction of a new plant
on land the company purchased for...
asked 5 hours ago -
1. Consider a linear regression model of y on K regressors and
an intercept.
(i) Describe...
asked 5 hours ago -
Enter a balanced equation for the reaction between hydrochloric
acid and sodium sulfite.
Express your answer...
asked 5 hours ago -
Give a regular expression describing the language
{x | x ∈ Σ* and x does not...
asked 5 hours ago -
Masses of 1.0 kg, 2.0 kg, and 3.0 kg are each separately subject
to a net...
asked 5 hours ago -
The mode of philosophical argumentation and thought. How do
philosophers think and write? What is important...
asked 5 hours ago