You hypothesize that expression of Gene X, a gene for which you know the complete sequence in the organism of interest, may be an important contributor to the development of a phenotype (trait) that you study (e.g. eye development). What approach(es) would you use to manipulate the expression pattern of the gene to test your hypothesis?
You hypothesize that expression of Gene X, a gene for which you know the complete sequence...
You hypothesize that a DNA sequence located 3.0 kb upstream of the promoter of a gene you are studying contains an enhancer. To test your hypothesis, you use recombinant DNA techniques to insert a DNA fragment containing this DNA sequence into a plasmid also containing a “reporter gene.” Note:A reporter gene encodes for a protein that you can detect when expressed. For example, you could use the lacZ gene that encodes for the enzyme β-Galactosidase as a reporter gene. As...
Sex determination in Mammals. You have identified a gene that you have named “mont1” (for ‘make ovaries not testes’) that is expressed at the time when the bipotential gonad becomes specified to become an ovary. Because of this “show it” evidence that mont1 is expressed in the right place at the right time, you hypothesize that mont1 is a critical regulator of the female primary sex determination pathway to specify ovary development. From what you know about the primary sex...
You are interested in studying the expression of Neurogenesis-2 (NG-2), a protein that may have a role in neurogenesis in the brain. You know that neurogenesis slows/stops as mice age, so you hypothesize that it will be highly expressed in young mice compared to old mice. (NG-2 is a fake protein used for this test question). Please note that you are being asked to analyze NG-2 at the PROTEIN level. Select appropriate techniques and technologies. (20 pts total). a) Describe...
You have a P-element induced mutation that is homozygous lethal. You think that the element might be inserted into the DMAP1 gene. Which of the following techniques can be used to confirm (or not) that DMAP 1 is the gene responsible for the lethality? Rescue using the DMAP1 cDNA ORNAi for DMAP1 Obtain a large deletion on the chromosome and test for failure to complement two of these all of these White eyed flies can be generated in several different...
This sequence encodes a protein that you wish to study further by cloning the gene. The protein of interest has a molecular weight of at least 10 kDa. The sequence was sequenced by a primer walking approach, but unfortunately the correct order of the sequence traces was lost (really bad lab notebook skills). Trace 1 aacgagttaaggagccagcgtaccttcgcaccgccatacatgaattttcttggctttttctatgtggatggcaatagtctagagtcggacctgcaggcatgcaag Trace 2 cagcctgttagtaggtcttactgagtcgggcgccgaattcgagctcggtacccggggatccatgagtgggcgccagttattcgtactattgggaggtcc Trace 3 ccgggtattttgtattcaatattgaataaggaatttttcatgcagagaaaaggatgtttacggctcgagcgcactcgcacatataactgtcggcagaaacgagttaaggagc Trace 4 tactattgggaggtccaaatggttttacgggagttgcactgggcgaatgctggagctattacgattcgtttaacatttccatatcgaattctcagacgactccgaatccgggtatttt Trace 5 cctgcaggcatgcaagcttggcataggtcagttcatccagggtgatgggtgtatcgtttcaatgacccgattcggaacg Answer the following-- Determine the correct order of the sequence traces and...
can you please answer all the questions Gene therapy can best be described as the OA. repair of a defect (mutation) in a gene B. insertion of normal genes to act in place of mutant genes Oc. insertion of human genes into other organisms D. cloning of genes to produce and purify therapeutically useful proteins E. mapping of all human genetic information Donot Selection Transmission genetics A. uses recombinant DNA technology to identify, isolate, and produce millions of copies of...
1) What are the two hypotheses of this experiment? What are you predictions for each hypotheses & briefly describe how you will test the given hypothesis and the one you generated. 2) What is a histogram AND why is it used for this lab instead of just plotting each individual's data? 3) Does the multi-year TRC (total ridge count) support each hypothesis? (explain your answer in terms of the shape and the position of the curve.) 4) What might account...
Molecular Bio lab. HELP!! Here is the first part: the sequence traces and the entire sequence. i just need the last 3 tasks. i color coded the ends so you can see where it overlaps and connects In the files section for your group there is a simulated output from an automated DNA sequencer using a variation of the classic Sanger method. (If you want to print it, it is formatted for legal sized paper.) This sequence encodes a protein...
What genes (or kind of genes) will you focus on in your investigative research? Provide 2-3 reasons for your choice of these gene/s. Starting with the bone sample itself, what methods will you use to get DNA that you can sequence? Which “ingredients” in your lab reactions will determine which gene or genes are copied? How is it that these ingredients are able to target a specific gene? What method will you use to see if your efforts to copy...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...