We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
a. What would be the produet oP spontanedus deamination of a hsine nould am b. If...
a. What would be the produet oP spontanedus deamination of a hsine nould am b. If not corrected, what will be the effect on the DNA sequence in the bottom strand upon replication? hould Describe the steps of the repair process that would most likely correct the deamination described in 4a. 5. a. What would be the produet oP spontanedus deamination of a hsine nould am b. If not corrected, what will be the effect on the DNA sequence in...
How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...
5. About double strand DNA repair, it is correct to say that choose the most appropriate answer): (a) It requires one intact strand as a template for error correction. (b) Mismatches in the DNA are usually corrected via double strand DNA repair mechanisms. (c) Homologous recombination usually results in DNA repair with no loss of nucleotide at repair site. (d) Non-homologous end-joining usually results in DNA repair with no loss of nucleotide at repair site. 6. A eukaryote gene has two introns and three exons....
Hello! I am working on this genetics problem and was wondering if you could check my letter d. I am not sure if this mRNA sequence is correct and would really appreciate the help. Thank you! 4. A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following DNA: _3'_ CGCTAGCTGCTTCCTTGGGGA 5'_ coding strand/non-template ||||||||||||||||||| _5'_ GCGATCGACGAAGGAACCCCT _3'_ template strand/non-coding a) Which strand is the non-template strand? The top strand b) Which strand is a non-coding stand?...
1)Repairing damaged DNA is essential to maintaining the integrity of the genome. One type of repair is known as nucleotide excision repair. In this system, which order do the necessary enzymes act? A) exonuclease, DNA polymerase III, RNA primase B) helicase, DNA polymerase I, DNA ligase C) DNA ligase, nuclease, helicase D) DNA polymerase I, DNA polymerase III, DNA ligase E) endonuclease, DNA polymerase II, DNA ligase 2) What might be the result if all cells had functioning telomerase? A)...
Please answer Q. 1, 35, 45, 57. Thanks! tory Bookmart People Tab Window Help What are the type o x Q Fir xam study ou * O carda Bem Gretar am Q Genetics Final Exam courses/213450/quizzes/255809/take D Question 1 1 pts The sequence of one strand of DNA is 5' TCGATC 3: The sequence of the complementary strand would be 3 TCGATCS 3' GCTAGC5 3 CTAGCTS O 3 GATCGAS 3' AGCTAGS D Question 2 1 pts Which of the following...
The type of ATPases associated with the integral binding of ATP as part of the transport process and possessing a conserved domain for the binding of ATP is the V type P type F type ABC type no correct choice listed How many replication forks are formed when an origin of replication is opened? 1 2 3 4 Either C or D and depends whether it is a eukaryotic or prokaryotic cell. What part of the DNA replication process would...
Question 7 2 pts Which of these genes would not likely be regulated by the bacterial SOS response?! Translesion DNA polymerase Cell division promoter Holliday junction branch migration enzyme Nucleotide excision repair enzyme Question 8 2 pts Which of these mutations is likely to have the greatest impact on the amino acid composition of the resulting protein? Silent Synonymous Frameshift Missense Question 9 2 pts What would be the result of perfect and continuous suppression of the lac operon in...
answer all the questions 1) All of the following contribute to promoter binding by RNA polymerase I in bacteria except: a)-10 consensus sequence b)-35 consensus sequence c) rho factor d) sigma factor e) none of the above 2) Common structural changes or lesions found in DNA after exposure to ultraviolet light are: a) thymine dimers b) cytosine dimers c) purine dimers d) adenine dimers e) none of the above 3) What is the function of the sigma subunit in the...
genetic biology 5'-GCATGAGTCTGGTACGCTTTTAAAGC-3' 3-CATGCG-5' IIIII 3. (a) in the sequence above, what enzyme would you need to extend the short stretch of nucleotides shown on the bottom strand? (b) Write the sequence of the newly synthesized fragment and label its S' and 3' end. (c) The covalent bond between these adjacent nucleotides is what type of chemical bond? After using a chemical mutagen to generate mutations in a DNA sequence, scientists noted a mutation from C to T at the...