Ans. 57 the right answer is nasal epithelial cells.
Many genes responsible for the immune response and inflammation are tightly regulated by Dna methylation, which suggedt that alteration of the epigenome in lung cells may have a considerable impact on the peneration and the severity of airway disease.herein we show that nasal epethilial cells are suitable to analyze Dna methylation in human disease primarily affecting the lower airway tract.
Please answer Q. 1, 35, 45, 57. Thanks! tory Bookmart People Tab Window Help What are...
tory Bookmart People Tab Window Help What are the type o x Q Fir xam study ou * O carda Bem Gretar am Q Genetics Final Exam courses/213450/quizzes/255809/take D Question 1 1 pts The sequence of one strand of DNA is 5' TCGATC 3: The sequence of the complementary strand would be 3 TCGATCS 3' GCTAGC5 3 CTAGCTS O 3 GATCGAS 3' AGCTAGS D Question 2 1 pts Which of the following is the condition of having additional whole sets...
please help with Q. 9, 22, 59, 72. thanks! Bookmarks People Tab Window Fra * Q Genetica Fral *1 ses/213459/quizzes/255809/take Help What are the typ * Q Fram Stud Pashcards - Be * Q D Question 9 1 pts Which of the following in determining the phenotype for the ABO blood system is correct? A. Ois dominant over A Ais dominant over B O is recessive Bis dominant over A D Question 10 1 pts Two phenotypically normal individuals have...
please answer Q. 44, 50, 52, 71. thanks! Question 44 1 pts Which of the following is a type of test to determine if a person is at higher risk of developing a particular disease later in life? Predispositional genetic testing Diagnostic testing Carrier testing Presymptomatic genetic testing Prenatal testing Question 45 1 pts Suppose a certain gene contains the double-stranded sequence: 5 - ATGTTTAGCGCC-3:34 TACAAATCGCGG-5. If the top strand is the sense strand, which of the following would be...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Question 33 2 pts Which of the following statements about the process of DNA replication is true? It involves the enzyme DNA ligase, which corrects point mutations. It utilizes DNA polymerase, which catalyzes the reaction that adds a new nucleotide to the growing strand. The sequence on the new strand is always identical to one of the old parent strands. Adenine pairs with guanine, and cytosine pairs with thymine. Question 34 2 pts The DNA base...
Write neat please and box the final answer please D Question 3 0.5 pts The RNA primers used to initiate replication in E.coli are removed by helicase + ATP. are joined together by DNA ligase result in Okazaki fragments on the leading strand. are removed by DNA Polymerase! Question 4 0.5 pts A nucleic acid was analyzed and found to contain 30 percent A. 20 percent G, 15 percent C, and 35 percent T. The nucleic acid must be double-stranded...
Consider the double-stranded DNA sequence of a gene below: Strand 1 5'- AATCGTATGCGAAGCCCTTAACT-3' Strand 2. С стената. 3. TTAGCATACGCTTCGGGAATTGA-5' The number of amino acids in the corresponding peptide is: OA.O B.1 OC3 0.4 O E.5 Consider the following double-stranded region of a gene: Strand 17 5'- AATCGTATGCGAAGCCCTTAACT-3 Strand 2A 3'-TTAG CATACGCTTCGGGAATTGA-5 The number of mRNA codons in the corresponding transcriptis O A1 OB.4 OC.5 OD.6 E. Cannot be determined
Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...
Question 25 4 pts Which of the following terms are associated with the discontinuously replicated strand during DNA replication? I. DNA ligase II. Okazaki fragments III. lagging strand IV. leading strand V. RNA polymerase O I, II, III O I, II, III, V O II, IV, V O I, II, IV, V O II, III, V 4 pts Question 26 4 pts Which of the following aids in recruitment of RNA polymerase to a promoter of a gene to initiate...
Please match the vocabulary words on the left side with the definitions on the right. the vocabulary word to the definition antiparallel A basic form of DNA in a double-stranded spiral chromatin B. a family of enzymes that catalyze the elongation of new DNA strands proteins that bind to DNA forming spools around which the DNA can be wound to form chromosomes DNA polymerase DNA replication D. short lengths of DNA that are made during DNA replication to make the...