![1 pts Question 4 Consider the following translated genetic sequence in the coding region of an gene: AUG[start]-CUU-GGC-UGU-C](http://img.homeworklib.com/questions/356e2350-0f8a-11ec-9706-f1f708cb178a.png?x-oss-process=image/resize,w_560)
Homework Answers
b. No, the point mutation codes for the same amino acid
In the above genetic sequence, UGU changes to UGC, both of which code for cysteine. Therefore, there will be no deleterious results of the mutation.
Add Answer to:
1 pts Question 4 Consider the following translated genetic sequence in the coding region of an...
Use the genetic code table to answer the following question: Second Base First Base Third Base...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
1. *A glycine residue is in position 210 of the tryptophan Second position synthetase enzyme of w...
1. *A glycine residue is in position 210 of the tryptophan Second position synthetase enzyme of wild-type E. coli. If the codon specifying glycine is GGA, how many single-base substitutions will result in an amino acid change at position 210? (0.4 pt) UAU tyr uGC Juc Phe UCU UUA UAA Stop UGA St UAG Stop UGG trp CAU CUU leu | CCC pro ICAA gin | CGG CUG CCA ProCAc hisCCU AUC ile ACC AUG met ACG leu CCU CUC...
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
Please explain Refer to the figure of the genetic code shown below. What is the sequence...
Please explain
Refer to the figure of the genetic code shown below. What is the sequence of amino acids coded for by the following section of mRNA? UCUGAUGGGCUUU Second Base UGU UuC UGC UUA UAA Stop UGA StopA UAG Stop UGG TrpG CUU CUc CUA CUG CGA AUC lle ACC AUA AUG Met or Start ACG GAU GAC GAA GAG GGU GGC GGA Val GUA
Question 24 Refer to the table below to answer the following question. А G U Serine...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
The following genomic DNA sequence comes from the first exon of a human gene and contains...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note:...
Bring this DNA sequence to protein using the transcription
(3pts) and translation (4 pts) processes.
note: Pending the direction your DNA is located
Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
D) Consider that during replication of the cell. the following mutations were generated within the gene...
D) Consider that during replication of the cell. the following mutations were generated within the gene sequence. Find the mutation (in bold Italics-underlined Specify the protein sequences for each mutant sequence. mutation type 1: This is a non-sense mutation because the codon does not code for an amino acid any more 5' -..AACTAATGCCGTAAGACGTATTTTGACTAAT..-3' (substitution of a C 7 A in codon 3) 3'- TTGATTACGGCAT ICTGCATAAAACTGATTA..-5 S mutation type 2: This is a missense mutation because the codon now codes for...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
1. *A glycine residue is in position 210 of the tryptophan Second position synthetase enzyme of wild-type E. coli. If the codon specifying glycine is GGA, how many single-base substitutions will result in an amino acid change at position 210? (0.4 pt) UAU tyr uGC Juc Phe UCU UUA UAA Stop UGA St UAG Stop UGG trp CAU CUU leu | CCC pro ICAA gin | CGG CUG CCA ProCAc hisCCU AUC ile ACC AUG met ACG leu CCU CUC...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
Please explain
Refer to the figure of the genetic code shown below. What is the sequence of amino acids coded for by the following section of mRNA? UCUGAUGGGCUUU Second Base UGU UuC UGC UUA UAA Stop UGA StopA UAG Stop UGG TrpG CUU CUc CUA CUG CGA AUC lle ACC AUA AUG Met or Start ACG GAU GAC GAA GAG GGU GGC GGA Val GUA
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
Bring this DNA sequence to protein using the transcription
(3pts) and translation (4 pts) processes.
note: Pending the direction your DNA is located
Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
D) Consider that during replication of the cell. the following mutations were generated within the gene sequence. Find the mutation (in bold Italics-underlined Specify the protein sequences for each mutant sequence. mutation type 1: This is a non-sense mutation because the codon does not code for an amino acid any more 5' -..AACTAATGCCGTAAGACGTATTTTGACTAAT..-3' (substitution of a C 7 A in codon 3) 3'- TTGATTACGGCAT ICTGCATAAAACTGATTA..-5 S mutation type 2: This is a missense mutation because the codon now codes for...
Most questions answered within 3 hours.
-
1 – Balance the following
Bi(OH)3 + SnO22- →
SnO32- +
Bi
asked 9 minutes ago -
Explain what we mean by "The electric field at the point marked
X is 10 N/C."...
asked 21 minutes ago -
What is the positive energy states in Dirac’s picture? It says
that it leaves an empty...
asked 19 minutes ago -
A mutual fund manager has a $20 million portfolio with a beta of
1.7. The risk-free...
asked 19 minutes ago -
Given the following contribution margin income statement
Sales (15000 units 35
$/units)
asked 19 minutes ago -
The heights in feet of some of the girls of SEU
are: 5.8, 6.1, 5.9, 5.4, 5.6,...
asked 51 minutes ago -
Caspian Sea Drinks is considering the purchase of a new water
filtration system produced by Rube...
asked 56 minutes ago -
Compare and contrast the
social media of Pepsi and Coke? which one is most effective and...
asked 56 minutes ago -
1.
Who initiates a lockout?
Group of answer choices
management
employees
unions
arbitrators
asked 57 minutes ago -
Many celebrities and public figures have Twitter accounts with
large numbers of followers. However, some of...
asked 1 hour ago -
In #13-16, use the following information. At the 0.01 level of
significance, test the claim that...
asked 1 hour ago -
Suppose you wanted to make a buffer with pH 3.00. What chemicals
would you grab off...
asked 1 hour ago