1.DNA template strand
2. DNA is produced during of replication
3. DNA POLYMERASE
4. creates a next copy of DNA that have to go into one of the two daughter cells when a cell divides.
5.CCTAGAATGCAA
In Class DNA Activity 50 points NAME: Henrietta Dolopei REPLICATION What type of nucleic acid is...
Complete each sentence to explain DNA replication. three parent strand as the During DNA replication, the double-stranded DNA bonds connecting the parent strands are broken. hydrogen covalent An enzyme called is responsible for this step. DNA polymerase helicase New position themselves along the parent strands through nucleotides two The nucleotides are joined to each oth by an enzyme called complementary base pairing unwinds Now, new daughter DNA molecules are produced, each consisting of one old and one new rendering DNA...
How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...
.Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A T A T T G T C A. T A G T A C A A G A B. C G A T A T T G T C C. G T C A A G A C C T D G C T A T A A C A G Select the strand of RNA that is complementary to this single strand of...
1. DNA is coiled around what type of proteins to form nucleosomes A. Polymerases DNA replication of the lagging strand is discontinuous B. Transcription factors DNA replication of the lagging strand is continuous C. Helicases D. Histones E. DICER 2. Which of the following statements is true? A. DNA replication of the leading strand is discontinuous B. DNA replication of the lagging strand is discontinuous C. DNA replication of the leading strand is dispersive D. DNA replication of the lagging...
1. (a) Assume that during DNA replication in a bacterium a mistake is made and a G is inserted into the newly synthesized DNA strand opposite a T in the template DNA strand. If this mistake is not repaired before the next round of DNA replication, what mutation will eventually result? Show your work (b) What type of mutation is the resulting mutation? (transversion, transition, indel, base substitution) 2. (a) What is the purpose of Taq polymerase in a PCR...
Hellesse ah vertanian Period: DNA Replication Worksheet Complete all of the following: ou Stand 3 105 1. Identify and label the letter X.509 2. Identify and label the letter Y Phone 3. Label and color all bases with the appropriate letter and color. Color code your key to match. 4. Identify and label the parent strands. 5. Identify the replication fork and add the enzyme helicase to the area where this is happening 6. Look at the area labeled with...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
“Unlike what happens in DNA replication, where both strands are copied, only one of the two strands is transcribed into mRNA. The DNA strand that contains the gene is sometimes called the sense strand, or coding strand, and the DNA strand that gets transcribed to give RNA is called the antisense strand, or noncoding strand. Because the sense strand and the antisense strand are complementary, and because the DNA antisense strand and the newly formed RNA strand are also complementary,...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...