Question

e. of ninot0 AOLL 2. A microarray is an orderly arrangement of short strands of DNA attached to a solid surface. Considering SNP microarrays, expression arrays and CNV arrays (array comparative genome hybridization): a. Which type of array(s) will not have intronic sequences attached to the solid surface? Why? b. Which type of array will have a larger proportion of the genome attached to the solid surface? Why? Which type of array would allow one to identify large stretches of homozygosity (regions where the sequence on both homologs is identical) in the genome of an individual? C. 3. To sequence a newly identified genome, the genome was fragmented, the fragments cloned and the clones sequenced (shotgun sequencing) generating the following 5 sequences. Place these sequences into a contig to identify the sequence of the genome. a. gattacattaaccggcatt b. actgtgcatatttagggcagtcccag c. aacgagtatatcataggcactgca d. tcccagcatcataggttag attacatta e. ttaaccggcattaggattcaacgag of afflicted individuals to grow larger when they tell a lie. You discover a

Answer 1

2) a)

Out of these three SNP Microarray, expression microarray, CNV microarray. Expression microarray is not have intrinsic sequence.

As expression analysis means , detection of mRNA and mRNA do not contain introns. So in expression microarray, we only analyze mRNA sequence made up of exons.

B) CNV microarray has higher amount of genome atta hed to fold surface . Because we are analyzing complete  genome of different species .

C) CNV microarray involve in identification of long stretch homozygocity.

SNP microarray used to detect variation at specific base pair.

2) we can make whole sequence bu using overlap method. Strand are must be put in following order in order to formation of full coding sequence.

d-a-e-c-b

They all are having complementary sequence to one other