Answers to both questions posted, please!
Homework Answers
Add Answer to:
Answers to both questions posted, please!
ve pie ces od shir o elling hree shit What...
please provide helpful answers for both questions posted. Thank you absolute purchasing power parity, what should...
please provide helpful answers for both questions
posted.
Thank you
absolute purchasing power parity, what should an identical A. $374.24 B. $387.05 C. $361.95 D. $388.52 E. $339.90 18. Assume you can currently exchange $100 for 780.25. The inflation rate in Europe is expected to be 1.8 percent as compared to 2.4 percent in the U.S. Based on relative purchasing power parity, what should the exchange rate be four years from now? A. €.8219/$1 B. €.8014/$1 C. €.7970/$1 D. €.8073/$1...
please do both .. but i know i should have posted seperate questions l Question 2 What is the most stable resona...
please do both .. but i know i should have posted seperate
questions
l
Question 2 What is the most stable resonance from for the all-aromatic compe Question 3 Which compound does NOT afford the indicated compound when subjected to benzylic oxidation, HOOC ноос Асоон Na CO H2O7H45047 LOOM moro 808
please select the correct answers for both questions You are conducting an appraisal for a house...
please select the correct answers for both questions
You are conducting an appraisal for a house located in North Kingstown. The house has the following attributes: lot size 24,100 sq. ft.,: floor area 2375 sq.ft.; 4 bedrooms, 2 baths; 2 car garage; appliances are original: year of construction 2016. In making this appraisal you plan to use a recent sale of a house that has the following attributes: Lot size 23,290sq. ft.; floor area above the basement 2435 sq.ft; 3...
please for both questions. Thanks QUESTION 32 In eukaryotes, DNA is packaged into complex structures called...
please for both questions. Thanks
QUESTION 32 In eukaryotes, DNA is packaged into complex structures called chromosomes. What is the total haploid number of chromosomes found in a human mature sperm cell? OA. 22 + X or 22 +Y OB. 48, XX or 48, XY OC.46, XX or 46, XY OD.23 + X or 23+Y QUESTION 33 The figure below depicts the nucleolus What is the nucleolus ? O A extended nucleosomes B. nuclear regions of rRNA synthesis C aggregates...
answer BOTH. please explain and answer both questions thoroughly. will only rate if both are answered. need answers asa...
answer BOTH. please explain and answer both questions
thoroughly. will only rate if both are answered. need answers
asap
4) Skeletal and cardiac muscle are both types of striated muscle. You have been given one type of each sample, but the identifying labels have come off. You know that these muscles have some similarities and some differences in terms of their rate of depolarization, rate of repolarization, and length of action potential. Which of these features would not be useful...
and please show what test you used for each question can someone please answers the questions...
and please show what test you used for each question
can someone please answers the questions A,B,C step by step please showing facts and theorems. (Updated) -Determine whether the series is convergent or divergene you need to use facts and theorems to support your answer. In these problems you do not have to And the Sum of any convergent senes. A. RR - 40² na 3n²+1 B. & Please n=1 Sin inel C. & noz show step by step to...
Answers to the questions please Sea grape (Coccoloba uvifera) .Evergreen o What kind of leaf arrangement...
Answers to the questions please
Sea grape (Coccoloba uvifera) .Evergreen o What kind of leaf arrangement does it have . Salt and water tolerant . Dioecious female tree bears fruit o Can you tell whether your tree is female or male o e Applications fruit can be eaten or used to make jelly o wood is boiled to make red dye in West Indies o gum from bark is used to treat throat ailments o roots are used to treat...
Please answer both parts a and b. Please explain your answer. (The marked answers in the...
Please answer both parts a and b. Please explain your answer.
(The marked answers in the pictures are incorrect!)
a)
b)
What are the 5 base pair primer sequences required to amplify the central region of the following template, such that the final PCR product will have a length of 20 nucleotides? 3' AGCTTGTCCAGTGGTCAGAGTCAGTAGCCGTAGG 5' Select one: O a. 5' CCAGT 3' and 5'CTACT 3' b. 5' GATGA 3' and 5' GGTCA 3' O O C.5'GAACA 3' and 5' ATGCC...
Can I have an answers for questions 1 and 2 please Discussions What is a standard cost and what are its purposes? 2....
Can I have an answers for questions 1 and 2 please
Discussions What is a standard cost and what are its purposes? 2. Assume variable manufacturing overhead is allocated using machine hours. Give three possible reasons for a favourable overhead efficiency variance. 1.
Discussions What is a standard cost and what are its purposes? 2. Assume variable manufacturing overhead is allocated using machine hours. Give three possible reasons for a favourable overhead efficiency variance. 1.
Need answers to both questions ECO 111: Macroeconomics Problem Set 2 Please answer all questions and...
Need answers to both questions
ECO 111: Macroeconomics Problem Set 2 Please answer all questions and submit your answer by 9:30 AM on Monday, November 4. Please clearly label all pages you submit with your name. Please fasten all pages you submit by, eg, stapling them or paperclipping them together Please do not laminate. This assignment assesses learning outcomes 3 and 4 from the syllabus 1. (4 points) The table below describes the supply and demand schedule for ice cream...
please provide helpful answers for both questions
posted.
Thank you
absolute purchasing power parity, what should an identical A. $374.24 B. $387.05 C. $361.95 D. $388.52 E. $339.90 18. Assume you can currently exchange $100 for 780.25. The inflation rate in Europe is expected to be 1.8 percent as compared to 2.4 percent in the U.S. Based on relative purchasing power parity, what should the exchange rate be four years from now? A. €.8219/$1 B. €.8014/$1 C. €.7970/$1 D. €.8073/$1...
please do both .. but i know i should have posted seperate
questions
l
Question 2 What is the most stable resonance from for the all-aromatic compe Question 3 Which compound does NOT afford the indicated compound when subjected to benzylic oxidation, HOOC ноос Асоон Na CO H2O7H45047 LOOM moro 808
please select the correct answers for both questions
You are conducting an appraisal for a house located in North Kingstown. The house has the following attributes: lot size 24,100 sq. ft.,: floor area 2375 sq.ft.; 4 bedrooms, 2 baths; 2 car garage; appliances are original: year of construction 2016. In making this appraisal you plan to use a recent sale of a house that has the following attributes: Lot size 23,290sq. ft.; floor area above the basement 2435 sq.ft; 3...
please for both questions. Thanks
QUESTION 32 In eukaryotes, DNA is packaged into complex structures called chromosomes. What is the total haploid number of chromosomes found in a human mature sperm cell? OA. 22 + X or 22 +Y OB. 48, XX or 48, XY OC.46, XX or 46, XY OD.23 + X or 23+Y QUESTION 33 The figure below depicts the nucleolus What is the nucleolus ? O A extended nucleosomes B. nuclear regions of rRNA synthesis C aggregates...
answer BOTH. please explain and answer both questions
thoroughly. will only rate if both are answered. need answers
asap
4) Skeletal and cardiac muscle are both types of striated muscle. You have been given one type of each sample, but the identifying labels have come off. You know that these muscles have some similarities and some differences in terms of their rate of depolarization, rate of repolarization, and length of action potential. Which of these features would not be useful...
and please show what test you used for each question
can someone please answers the questions A,B,C step by step please showing facts and theorems. (Updated) -Determine whether the series is convergent or divergene you need to use facts and theorems to support your answer. In these problems you do not have to And the Sum of any convergent senes. A. RR - 40² na 3n²+1 B. & Please n=1 Sin inel C. & noz show step by step to...
Answers to the questions please
Sea grape (Coccoloba uvifera) .Evergreen o What kind of leaf arrangement does it have . Salt and water tolerant . Dioecious female tree bears fruit o Can you tell whether your tree is female or male o e Applications fruit can be eaten or used to make jelly o wood is boiled to make red dye in West Indies o gum from bark is used to treat throat ailments o roots are used to treat...
Please answer both parts a and b. Please explain your answer.
(The marked answers in the pictures are incorrect!)
a)
b)
What are the 5 base pair primer sequences required to amplify the central region of the following template, such that the final PCR product will have a length of 20 nucleotides? 3' AGCTTGTCCAGTGGTCAGAGTCAGTAGCCGTAGG 5' Select one: O a. 5' CCAGT 3' and 5'CTACT 3' b. 5' GATGA 3' and 5' GGTCA 3' O O C.5'GAACA 3' and 5' ATGCC...
Can I have an answers for questions 1 and 2 please
Discussions What is a standard cost and what are its purposes? 2. Assume variable manufacturing overhead is allocated using machine hours. Give three possible reasons for a favourable overhead efficiency variance. 1.
Discussions What is a standard cost and what are its purposes? 2. Assume variable manufacturing overhead is allocated using machine hours. Give three possible reasons for a favourable overhead efficiency variance. 1.
Need answers to both questions
ECO 111: Macroeconomics Problem Set 2 Please answer all questions and submit your answer by 9:30 AM on Monday, November 4. Please clearly label all pages you submit with your name. Please fasten all pages you submit by, eg, stapling them or paperclipping them together Please do not laminate. This assignment assesses learning outcomes 3 and 4 from the syllabus 1. (4 points) The table below describes the supply and demand schedule for ice cream...
Most questions answered within 3 hours.
-
Caculate the PH THANK YOU!
[OH−] = 1.9×10−7 M
[OH−] = 1.6×10−8 M
[OH−] = 7.2×10−11...
asked 38 seconds from now -
Suppose you drive an old truck with a 32 gallon gas tank that
gets 16 miles/gallon....
asked 1 minute ago -
As
an analyst you believe that Acme Company will pay a dividend of $3
per share...
asked 5 minutes ago -
Claim: At most 81% of adults do not have hypertension. When 869
randomly selected adults were...
asked 22 minutes ago -
Assume a class has 19 members.
a. In how many ways can a president, a vice...
asked 20 minutes ago -
What could be a possible reason that protozoan infections are
increasing in the United States
asked 18 minutes ago -
Implement a Full Adder with two 4x1 Mux and the MSB as possible
inputs of the...
asked 28 minutes ago -
offering the survey (maybe via smart phones) is a good idea?
why?
asked 25 minutes ago -
2. Construct a business plan for your proposed business in
question 1, paying particular attention to:...
asked 22 minutes ago -
1. Choose a work situation in which you were required to do a
lot of creative...
asked 29 minutes ago -
An aqueous solution of barium hydroxide is
standardized by titration with a 0.196 M solution
of...
asked 1 hour ago -
accorsing to the data from thw college board, the mean wuantitive
Sat score for s demale...
asked 2 hours ago