You create a genomic library and then preform shotgun sequencing to generate the following set of 6 sequences (all orientated 5’ to 3’).
Based on these data, assemble the most likely sequence contig. Provide the sequence and the order of sequence reads. What is the difference between a sequence read and a sequence contig?
You create a genomic library and then preform shotgun sequencing to generate the following set of...
Three short sequence reads from a genomic library made by partial digestion with Sau 3Al and ligation into the Bam Hl site of plasmid vectors are shown below. Do all three of the following 20 nt sequence reads generate a single contig? If so, how long is that contig? (For the purpose of this question, 8 nt of sequence overlap is sufficient for any two reads to form a contig.) read 1: 5' AAAGTCAACCTGTATTGGCC 3 read 2: 5' GCGCGCTATAGGCCAATACA 3'...
Short and clear answers please! Thank you Question 2: Advances in DNA sequencing, 5 points A. 3 points. Imagine you are explaining the revolution in DNA sequencing to a relative. You're trying to explain to them why the price dropped one-million fold. The major key advance that lead to this drop in price is: B. 1 point. In Next Generation Sequencing, dsDNA linkers are added to each of the fragmented pieces of DNA. This linker enables the fragments to stick...
6) Many scientists doubted that shotgun sequencing would work, even with the smallest genomes, because: a. There would not be overlaps between the different mini-sequences. b. Computers would be unable to handle the huge amount of data generated by a shotgun sequencing project. c. Small prokaryotic genomes contain large amounts of repetitive DNA. d. No method existed for breaking genomic DNA into random fragments. 7) In a PCR-RFLP assay, enzyme digestion revealed three bands (152+187+462bp) in AA animals, four bands...
Question 4 Part A [10 marks] A human genome has been re-sequenced using a sequencing technology that produces 100 bp reads of high quality data. The DNA was sheared to make a paired-end library with a size range of 1500 bp +- 500 bp and sequenced to generate paired-end reads. The analysis pipeline takes short-read sequence data and aligns it to a repeat-masked version of the reference human genome sequence assembly using BLASTN. This table summarizes the results from three...
command 145 Genetics Assignment Genomic Analysis 1. Some bacteria normally produce endonucleases for what purpose? a) necessary digestion of their own genome b) defense against viral infection c) bacteria never make endonucleases naturally 2. A blunt cutter produces DNA fragments with complementary overhanging regions. a) True b) False 3. Which of the following DNA sequences (when double-stranded) most likely represents a restriction endonuclease site for a 6-mer cutter? a) AGTAAGCTTC c) AGAGAGCCAA b) GGTAGATTCC d) None of the above 4....
Use the set of the frequent item sequences to generate sequential rules (No need to generate the frequent item sequences!). For each rule, calculate the support and the confidence. Here is an example: consider the rule the frequent itemset <{ Eggs },{Tomatoes},{Vinegar}>. From this itemset we can create a sequential rule <{ Eggs },{Tomatoes}> -> <{Vinegar}> which says that if a customer bought Eggs and Tomatoes already, they are likely to buy Vinegar at a later time. Remember, the order...
Solve in R/R Studio code - Q3. In this problem you wil use LDA, QDA and KNN to predict whether a given car gets high or low mileage based on the Auto data set in the ISLR library a. Create a binary variable, mpg01, that contains a 1 if mpg contains a value above its median, and a 0 if mpg contains a value below its median. You can compute the median using the median) function. You may also find...
Draw (or arrange) only the items you need from the Lab Materials Page (picture below) in the order you would use them to make AND screen a gene library. You will ‘draw’ the steps that use the Lab Materials in the correct order to create and screen a gene library which has the assigned gene clone. You will need to add some connecting words and phrases to make all the steps for making your library clear. The genomic gene clone...
AA. Final Project - Improved JavaFX GUI Personal Lending Library Description: In this project we will improve our personal lending library tool by (1) adding the ability to delete items from the library, (2) creating a graphical user interface that shows the contents of the library and allows the user to add, delete, check out, or check in an item. (3) using a file to store the library contents so that they persist between program executions, and (4) removing the...
and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentration; shape O d. size, charge O e. size; shape Refer to the table. Several strains of a bacterium are sequenced to investigate the pan and core genomes. In the table, + denotes presence of the gene and denotes its absence. Gene Gene Gene Gene Gene Strain ! Strain 2 + Strain 3 + Strain 4 + + + + Strain 5 + + What...