Given the following transcripts: 1.) 5' - AUG GUG CAC CUG ACU CCU GAG GAG AAG...
Given the following transcripts:
1.) 5' - AUG GUG CAC CUG ACU CCU GAG GAG AAG UCU GCC GUU ACU -3'
2.) 5' - AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU - 3'
I need to determine what difference exist between the two transcripts. How is GAG in transcript #1 different then GUG in transcript #2? What does this mean?
Thank you!
Homework Answers
In transcript 1, GAG codes for Glutamic acid.
In transcript 2, GUG codes for valine.
This is classically seen in sickel cell Anemia.
Where the beta chain of globin protein, at 6th position, Glutamic acid is replaced by valine. This causes changes in the structure if Hemoglobin resulting in sickel cell disease.
Now as a single base is altered,this is an example of point mutation.
Add Answer to:
Given the following transcripts:
1.) 5' - AUG GUG CAC CUG ACU CCU GAG GAG AAG...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
Use the genetic code table to answer the following question: Second Base First Base Third Base...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
Amino Acid Sequence Codoms Snicker's mRNA S-AUG GUA UCU AAA (GUU CCU ACU GAA AAGCUU CUC...
Amino Acid Sequence Codoms Snicker's mRNA S-AUG GUA UCU AAA (GUU CCU ACU GAA AAGCUU CUC CUC CCCI GUU GCG GCU CAUCACIGUA UUU UAUIGUA AU CUU CUG CCC ACA GUU GAC GAC GCAUUC UCG GGU LAGA UAU UGUJUAA Antisense Strand DNA: Sense Strand DNA 53 Amino Acid Sequence Genel body covering Gene 2 - body style Gene 3 - legs Gene 4 - head shape Gene Stails Gene 6 - body pigment Gene 7 - eyes Gene 8 - mouth...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note:...
Bring this DNA sequence to protein using the transcription
(3pts) and translation (4 pts) processes.
note: Pending the direction your DNA is located
Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3'...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
Amino Acid Sequence Codoms Snicker's mRNA S-AUG GUA UCU AAA (GUU CCU ACU GAA AAGCUU CUC CUC CCCI GUU GCG GCU CAUCACIGUA UUU UAUIGUA AU CUU CUG CCC ACA GUU GAC GAC GCAUUC UCG GGU LAGA UAU UGUJUAA Antisense Strand DNA: Sense Strand DNA 53 Amino Acid Sequence Genel body covering Gene 2 - body style Gene 3 - legs Gene 4 - head shape Gene Stails Gene 6 - body pigment Gene 7 - eyes Gene 8 - mouth...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
Bring this DNA sequence to protein using the transcription
(3pts) and translation (4 pts) processes.
note: Pending the direction your DNA is located
Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
Most questions answered within 3 hours.
-
Atmospheric Mass
Venus and Earth have about the same mass and radius, but the
atmospheric pressure...
asked 11 minutes ago -
5. Discuss the use of fault tree analysis (FTA) for risk
assessment (maximum one paragraph).
asked 1 hour ago -
Given that a sample of aluminium oxide has a Young's modulus of
393 GPa and a...
asked 2 hours ago -
At a certain temperature, the equilibrium constant, Kc, for this
reaction is 53.3.
H2(g)+I2(g)−⇀↽−2HI(g)Kc=53.3
At this...
asked 4 hours ago -
Question1 ) The STL provides similiar classes called stack and
queue, both of which gave functions...
asked 5 hours ago -
For Questions 1-4, assume you have 5 bits available:
1. For (positive) integers: What is the...
asked 5 hours ago -
convert grams into vloume with the density of water being at
.997514 g/cm^3 at 23.1 Celsuis...
asked 7 hours ago -
Foreman company obtained a $20,000, 6% loan on May 1, 2018.
Principal and interest will be...
asked 7 hours ago -
5. Problem 11.05 (Discounted Payback)
eBook
Project L costs $60,000, its expected cash inflows are $14,000
per...
asked 7 hours ago -
1. Which of the following is true about politics and health
organizations?
A. Health organizations are...
asked 8 hours ago -
A space vehicle is coasting at a constant velocity of 18.1 m/s
in the +y direction...
asked 9 hours ago -
5) Use the following balanced equation to answer questions
(a)-(i).
3 Cu(s) + 8 HNO3(aq) →...
asked 8 hours ago