What condition refers to abnormally high levels of blood glucose? hyperglycemia hypoglycemia hypertension hyperlipidemia
What condition refers to abnormally high levels of blood glucose?
| hyperglycemia |
| hypoglycemia |
| hypertension |
| hyperlipidemia |
Homework Answers
Hyperglycemia-can affect people with both type 1 and type 2 diabetes
Symptoms
Early signs include:
- Increase thirst
- Headaches
- Blurred vision
- Fatigue (weak, tired feeling)
- Weight loss
- Blood sugar more than 180 mg/dL
Ongoing high blood sugar may cause:
- Vaginal and skin infections
- Slow-healing cuts and sores
- bad vision
- Nerve damage causing painful cold or insensitive feet, loss of hair on the lower extremities.
- Stomach and intestinal problems such as chronic constipation or diarrhea
- Damage to your eyes, blood vessels, or kidneys
Add Answer to:
What condition refers to abnormally high levels of blood
glucose?
hyperglycemia
hypoglycemia
hypertension
hyperlipidemia
Q3: Hypoglycemia occurs when there are low levels of glucose in the blood of a healthy...
Q3: Hypoglycemia occurs when there are low levels of glucose in the blood of a healthy human. What is a way to "correct" hypoglycemia? 1- Decrease the secretion of thyroid hormones. 2- Increase the secretion of glucagon. 3-Increase the secretion of both insulin and glucagon. 4-Decrease the secretion of both insulin and glucagon. 5- Increase the secretion of insulin.
high blood pressure and is elevated blood glucose levels. Explain what, physiologically, is occuring with the...
high blood pressure and is elevated blood glucose levels. Explain what, physiologically, is occuring with the client in regards to her diet What could she be eating replace to improve her high blood pressure and glucose intolerance? she eiminate trom her det andeor to cause these issues, why are these issues occuring, what should 2. at is the difference between a diet f refined, starchy car rates whole grain carbohydrates? How does this difference effect one's blood g levels?
26. Why did Jessie’s carnitine deficiency cause her to have abnormally low plasma glucose levels at the end of a fasting...
26. Why did Jessie’s carnitine deficiency cause her to have abnormally low plasma glucose levels at the end of a fasting study, when compared to a healthy person who has fasted for the same length of time? In the absence of carnitine, the liver stores large amounts of glycogen; absorption of glucose to create these stores depletes blood glucose Carnitine acts as a hormone and stimulates glucose release from the liver; lack of carnitine results in loss of hepatic glucose...
The patient was a 2 year old boy who presented with fasting hypoglycemia and acidosis. The...
The patient was a 2 year old boy who presented with fasting hypoglycemia and acidosis. The liver was enlarged three-fold and kidneys two-fold. Hypoglycemia responded to oral doses of glucose but not to administered glucagon or epinephrine. During hypoglycemic episodes, lactic acid in the blood increased almost 10-fold higher than normal. Unlike the response in normal individuals, administration of oral galactose did not increase blood glucose concentrations but blood lactate levels were increased. Urine contained high levels of lactate. A...
d. She finds a mutation in which blood sugar levels stay abnormally high after meals. To...
d. She finds a mutation in which blood sugar levels stay abnormally high after meals. To identify the location of this mutation she decides to sequence the genome of homozygous mutant embryos. She compares this sequence to a sequence from a homozygous wildtype sibling. These sequences are below. Wt AGAGGATGATCCTAAACAAAGCTCTGATCCTG Mut AGAGGATGATACTAAACAAGCTCTGATCCTGG i. What kind of mutations did she find in her sequence? Label them and indicate the type of mutation. (15 pts) ii. How are these mutations likely to...
A forensic scientist receives a blood sample that has abnormally high quantities of white blood cells....
A forensic scientist receives a blood sample that has abnormally high quantities of white blood cells. What does this indicate about the person the blood came from?
11. What are the goals or target A1C & blood glucose levels in diabetes and gestational diabetesCheck book and...
11. What are the goals or target A1C & blood glucose levels in diabetes and gestational diabetesCheck book and www.nutritioncaremanual.org for answers. Fill out chart. Normal Values(Not Diabetes Diabetes Gestational DM Goals pregnant/Non-Diabetie): (Diagnosis) Goals: (varies) Fasting Blood ADA, NCM 2014: sugar: S105 mg/di (goals vary w source) AIC: n/a Postprandial: 3140 mg/dl (1 hr post meal) 120 mg/dl (2 hr pp) 12. Note that goals for diabetes is different that "normal" levels. Why is that? 13. Urinary ketones should...
levels rise after its consumption. Research indicates that high-glycemic index foods raise blood glucose levels rapidly...
levels rise after its consumption. Research indicates that high-glycemic index foods raise blood glucose levels rapidly and increase the risk of obesity, type 2 diabetes, The glycemic index of a food relates to how quickly blood glucose after its cardiovaseular disease. Read the following article and then respond to the questions. Brody, Jane E. "The Fats You Don't Need to Fear." New York Times 19 Oct. 2015. Health Reference Center Academic. Web. 6 Dec. 2015 1. When calculating the glycemic...
Model 2 - Feedback Control of Blood Glucose Pancreas .. Liver Other cells OO Blood glucose...
Model 2 - Feedback Control of Blood Glucose Pancreas .. Liver Other cells OO Blood glucose is too high. Cycle A Blood glucose drops. Baseline blood glucose level. Blood glucose rises. Glucose Insulin Glycogen Glucagon Cycle B Blood glucose is too low. 7. Where in the body does insulin and glucagon originate? 8. In what form is glucose stored in the liver and what is the consequence in terms of glucose blood levels? 10. Which hormone (insulin or glucagon) helps...
Sheila's doctor is concerned that she may suffer from gestational diabetes (high blood glucose levels during...
Sheila's doctor is concerned that she may suffer from gestational diabetes (high blood glucose levels during pregnancy). There is variation both in the actual glucose level and in the blood test that measures the level. A patient is classified as having gestational diabetes if the glucose level is above 140 miligrams per deciliter (mg/dl) one hour after having a sugary drink. Sheila's measured glucose level one hour after the sugary drink varies according to the Normal distribution with μμ =...
high blood pressure and is elevated blood glucose levels. Explain what, physiologically, is occuring with the client in regards to her diet What could she be eating replace to improve her high blood pressure and glucose intolerance? she eiminate trom her det andeor to cause these issues, why are these issues occuring, what should 2. at is the difference between a diet f refined, starchy car rates whole grain carbohydrates? How does this difference effect one's blood g levels?
d. She finds a mutation in which blood sugar levels stay abnormally high after meals. To identify the location of this mutation she decides to sequence the genome of homozygous mutant embryos. She compares this sequence to a sequence from a homozygous wildtype sibling. These sequences are below. Wt AGAGGATGATCCTAAACAAAGCTCTGATCCTG Mut AGAGGATGATACTAAACAAGCTCTGATCCTGG i. What kind of mutations did she find in her sequence? Label them and indicate the type of mutation. (15 pts) ii. How are these mutations likely to...
11. What are the goals or target A1C & blood glucose levels in diabetes and gestational diabetesCheck book and www.nutritioncaremanual.org for answers. Fill out chart. Normal Values(Not Diabetes Diabetes Gestational DM Goals pregnant/Non-Diabetie): (Diagnosis) Goals: (varies) Fasting Blood ADA, NCM 2014: sugar: S105 mg/di (goals vary w source) AIC: n/a Postprandial: 3140 mg/dl (1 hr post meal) 120 mg/dl (2 hr pp) 12. Note that goals for diabetes is different that "normal" levels. Why is that? 13. Urinary ketones should...
levels rise after its consumption. Research indicates that high-glycemic index foods raise blood glucose levels rapidly and increase the risk of obesity, type 2 diabetes, The glycemic index of a food relates to how quickly blood glucose after its cardiovaseular disease. Read the following article and then respond to the questions. Brody, Jane E. "The Fats You Don't Need to Fear." New York Times 19 Oct. 2015. Health Reference Center Academic. Web. 6 Dec. 2015 1. When calculating the glycemic...
Model 2 - Feedback Control of Blood Glucose Pancreas .. Liver Other cells OO Blood glucose is too high. Cycle A Blood glucose drops. Baseline blood glucose level. Blood glucose rises. Glucose Insulin Glycogen Glucagon Cycle B Blood glucose is too low. 7. Where in the body does insulin and glucagon originate? 8. In what form is glucose stored in the liver and what is the consequence in terms of glucose blood levels? 10. Which hormone (insulin or glucagon) helps...
Most questions answered within 3 hours.
-
.13 : Assume that we make an enhancement to a computer that
improves some mode of...
asked 32 seconds ago -
4)
Find the tension in an elevator cable if the 1000 kg elevator is
descending with...
asked 6 minutes ago -
A random sample of 51 newborn babies was taken at the Hospital.
The sample mean was...
asked 4 minutes ago -
Industry standards suggest that 16% of new vehicles require
warranty service within the first year. Jones...
asked 15 minutes ago -
1) Comment of this statement: “A compiler transforms high-level
language statements directly into object codes”.
asked 18 minutes ago -
Calculate the molality, mole-fraction and percent mass of 28.9M
HF at 25 degrees Celcius of the...
asked 27 minutes ago -
A developmental psychologist believes that children raised in
bilingual families will have higher verbal fluency at...
asked 34 minutes ago -
A fast food meal has 5660 kJ of energy. A person uses energy at
a rate...
asked 46 minutes ago -
The pKb for a generic amine(R-NH2)) in
aqueous solution is 6.30. What is its pKa?
asked 48 minutes ago -
The following reactions have the indicated equilibrium constants
at a particular temperature: N2(g) + O2(g) ⇌...
asked 50 minutes ago -
Please Help ASAP.
1Consider the below code which iterates over a linked
list of n nodes...
asked 1 hour ago -
Determine the air to fuel ratio of:
Canadian natural gas, with 93.9% methane, 4.2% ethane, 0.3%...
asked 1 hour ago