Question

3. EML is a protein that is produced at low levels in healthy cells, but is...

3. EML is a protein that is produced at low levels in healthy cells, but is highly expressed in cancer cells. You know that EML expression correlates with HER2 activity in cancer cells, but you do not know if EML causes HER2 activation or if HER2 activation induces EML expression.

a. Your PI thinks that it would be a good idea to look into quantifying expression of EML. What method would you use?

b. The particular method you most likely selected in part a utilizes SYBR green and generates a Ct value. What does SYBR green do? What is the point of having a Ct value? After using CRISPR/Cas9 to knock out the HER2 gene in a healthy cell line, you transform this CRISPR-edited HER2-/- cell line into cancer cells. When comparing the expression of EML in the HER2-/- vs the wild type cancer (assume the HER2 gene is intact) cell lines, you find that the Ct value of EML is significantly higher in the HER2-/- cells. What conclusion about the relationship between HER2 and EML does this experiment suggest?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

3.a. To quantify the expression of EML we can use several methods like western blotting, ELISA, RT-PCR to quantify the expression of a protein. to check the expression relation between EML and HER2, either one of them can be inhibited using either siRNA technology, specific inhibitors or knocking out genes using CRISPR/Cas9.

b. particular method selected, utilizes SYBR green to bind to DNA, generating Ct (cycle threshold) value is PCR. In PCR, when DNA concentration increases SYBR attachment to DNA increases and more flouroscence is observed. on comparison of EML expression as said above, Ct value were high in HER2 knockout cells, which establishes negative relation between HER2 and EML. If activation of either of them were to be regulated by the other one then, the expression would have down-regulated.

Add a comment
Know the answer?
Add Answer to:
3. EML is a protein that is produced at low levels in healthy cells, but is...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • For the questions below, be sure to write all oligonucleotide sequences 5'+3'. You are researching a...

    For the questions below, be sure to write all oligonucleotide sequences 5'+3'. You are researching a rare human leukemia that is caused by a mutation in a small protein called Cdr (for Cell Division Regulator). It has been found that patients with this rare leukemia contain a mutation in the 5' untranslated region of cdr. The mutation is a GỮA transition at nucleotide 7 of the transcript. Human Chromosome G7A 5' (sense strand) sequence included in cdr transcript gtactgcctattatgcagtettataagaaactaggtgccatggccttgacaggttctattagacactgtcggttgggcagacataatgagtctctagttgatgggagacgaccacgctgtcagtaagtactttttgcettcttatgccgtaccgac DNA...

  • 25. Mendel's factors undergo segregation and independent assortment. How is this illustrated in the chromosomes during...

    25. Mendel's factors undergo segregation and independent assortment. How is this illustrated in the chromosomes during Meiosis I? 26. Explain how these inheritance patterns are considered non-Mendelian. Incomplete Dominance . Multiple Alleles • Codominance X-linked Linkage . Pedigrees - Genetic Disorders 27. What is non-disjunction and how does it affect the chromosome distribution during meiosis? 28. What is a karyotype and what does it allow you to do? 29. Fill in the circles and squares to illustrate the following inheritance...

  • please help table 1 , Question 1 and 10 procedure is done which is the color...

    please help table 1 , Question 1 and 10 procedure is done which is the color result taly Color in results from the slide microarray or attach a photo Label each gene appropriately O O o ооо Figure 1. Color Intensity chart Expression Ratios 16 1/4 1/8 1/16 Table 1 Gene 1 Gene 2 Gene 3 Gene 4 Gene 5 Gene 6 Expression Ratio Decimal Value Log2 Value Paper Microarray Exercise 1. Describe which genes were induced or repressed in...

  • Unit 3 Study Resource Meiosis • Process by which diploid cells create haploid cells NOT part...

    Unit 3 Study Resource Meiosis • Process by which diploid cells create haploid cells NOT part of the cell cycle > only some cells ever undergo meiosis During meiosis I, homologous chromosomes line up to allow them to be separated into two new cells o They can become "tangled" during this phase, which leads to crossing-over (rearranging the alleles) O Result of meiosis I is two non-identical haploid cells Meiosis Il looks very similar to mitosis, in that sister chromatids...

  • 2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving...

    2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...

  • Telomere Length Estimation Objective To estimate the length of telomeres on your extracted gDNA. Background Telomeres...

    Telomere Length Estimation Objective To estimate the length of telomeres on your extracted gDNA. Background Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect chromosomes from degradation and genetic information loss. Normal diploid cells lose telomeres with each cell cycle. Telomere length, therefore, decreases over time and may predict lifespan. Telomere shortening has negative effects on health conditions and has been linked to many health issues including aging and cancer. Accurate and consistent quantification of telomere length...

  • 1. According to the paper, what does lactate dehydrogenase (LDH) do and what does it allow...

    1. According to the paper, what does lactate dehydrogenase (LDH) do and what does it allow to happen within the myofiber? (5 points) 2. According to the paper, what is the major disadvantage of relying on glycolysis during high-intensity exercise? (5 points) 3. Using Figure 1 in the paper, briefly describe the different sources of ATP production at 50% versus 90% AND explain whether you believe this depiction of ATP production applies to a Type IIX myofiber in a human....

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT