1. Would Justin Bieber have been “discovered” pre YouTube? How has the internet created a new generation of musical successes?
2. Can artistic success in 2019 be harnessed without social media?
1) In my opinion Justin Beiber would have not been "discovered" pre YouTube, because there would have been no definite platform to let him share his talent with the world. If there had been no YouTube, justin Beiber would have not got any opportunity to make home videos and post them and neither had Scooter Braun, the talent manager, accidently come across his videos. Even if he had been discovered by some other way the recognition, popularity and fame he has today would have not been the same and he might have got unnoticed and had have not received such huge attention as he got from YouTube by reaching to masses.
Internet has boomed the music industry with success, in fact the various social media channels and applications are a reason that music industry has become so diverse today with variety of types.
As internet connects people globally, it has also enabled the new musicians who might have otherwise went unnoticed,, to find audience for themselves and connect to people. Internet has inclined people more towards music as music is streaming everywhere now. It is no more restricted to certain publishing companies but it is self emerging. There are so many new and you g singers who have got recognition through internet. The best example as mentioned is Justin Bieber who was discovered through YouTube and hot popularity from Youtube.
Internet had made music more accessible to people and it has made it go through such trends that music if any kind is today liked by everybody. Moreover internet has made it easier and cheaper for musicians to reach to massess and audience inturn is open to listen to songs through music applications.
.
2) In my opinion Artistic jobs have a very restricted target audience and considerably less people have a specific art as their major interests. Therefore if not unveiled at a huge platform such as social media might not be harnessed in a way that social media has the potential to harness it. Social media is A place where every type of customer is present and thus an artist can easily find the audience it wants,,, therefore in the present era artistic job is getting so much of attention and more audience is driven towards arts because of the innovation and amazing content reflected through social media. Also social media provides an opportunity to artists to showcase their talent to huge masses. Social media connects people globally and thus it is possible for an artist to have an audience and customers located overseas. This would have not been able without social media. Thus artistic success in 2019 cannot be harnessed without social media.
Thanks dear student :)
Hope I explained well :) Good luck and God bless :)
Please rate if satisfied :) that will be encouraging :)
1. Would Justin Bieber have been “discovered” pre YouTube? How has the internet created a new...
questions 1
what are the communication needs that Justin has at:
• home?
• work?
Questions 2
what communication strategies does justin employ?
Questions 3
what further communication resources are available to justin?
Questions 4
What positive approaches and strategies would be best to promote
Justin's enjoyment and engagement with his community?
Questions 5
is Justin's supervisor meeting his duty of care to justin and
Ethan? could he do more? explain your answer.
questions 6
how is the principal of...
1. Write what would be an effective title for the passage. 2. What kind of language is used? 3. What are some related words which help unify the passage? 4. What is the purpose (persuade, inform or entertain) and what do you base that on? 5. Write the thesis in your own words. Social media has been growing in popularity since its beginnings in the early 2000s. With this rise in popularity comes more social media use by children and...
NEED ANSWER ASAP / ANSWER NEVER USED BEFORE, COMPLETELY NEW ANSWER PLEASE Changes in advancement to technology with the advent of internet have created business across national boundaries with challenges as well as opportunities. However, effective communication between customers and employees present problems with call centers (language or dialect), and interpreting website marketing and promotions, along with social media (i.e. Facebook, Twitter, Instagram, and LinkedIn). Assignment: Research how communication is impacted between customers and employees in problems with call centers (language...
1. A young couple has been trying to conceive for over a year and has been unsuccessful. They are now exploring their options and seeking fertility counseling. A. What are their options? B. How can the nurse assist this process? C. What are some potential nursing diagnoses in this situation? 1, 2, 7 2. A male client is upset by all the testing that is occurring to determine why he and his wife have not conceived. He is sure she...
INFORMATION MANAGEMENT QUESTION 1 Ethical issues in information systems have been given new urgency by the rise of the internet and electronic commerce. Internet and digital firm technologies make it easier than ever to assemble, integrate, and distribute personal privacy, and the protection of intellectual property. Discuss in detail the ethical, social, and political issues raised by information systems? QUESTION 2 Systems are vulnerable due to the large amounts of data they store in an electronic from. Vulnerabilities can occur...
"It has never been easier to launch a new brand" This article headline is about how consumer product brands have been able to launch more easily (and successfully) due to lower costs of manufacturing and an improved ability to target potential customer's through social media. If all of this is true, which of the following forces likely has experienced the strongest change in overall power? Supplier Power Substitutes Buyer Power Barriers to Entry
- The LEGO company’s Lego brick has been awarded “Toy of the Century”, one of the most elite titles awarded in the toy industry. - Initially, with the outbreak of social media, this company struggled to find a way of marketing their product through social media. - The social web was eventually utilized by the company to build relationships with customers, generate new product ideas by sharing proprietary information, and better understand their customers. - Through online interactions, the company...
A new mutation has been discovered that causes cancer. You have identified the gene sequence where the mutation occurs. Below is the sequence from your mother who is normal and you who have this mutation in your DNA. Mother: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUCAACCUAUCCCUAAGGGUAAAAA 3' You: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUGAACCUAUCCCUAAGGGUAAAAA 3' What type of mutation is shown in your DNA sequence? 01) Nonsense 2) Deletion 3) Missense 4) Frame shift
ead the article "How the Internet Has Changed the Salesperson's
role". Then provide your thoughts on the following questions:
In transactional sales situations, the personal sales agents
will be obsolete 10 years from now.
Discuss if you:
(1) agree or disagree,
(2) why, and
(3) provide examples of organizations
here is the aricle
Oct 13, 2017 - Matthew Cook, Director of Sales Enablement
Practice
The
art of selling has been dramatically altered since the rise of the
internet and the...