You have identified a recessive mutation in the mouse, in which expression of the mouse dickkopf gene is strongly disrupted (i.e., expression is reduced to 5% of normal levels). Individuals homozygous for this mutation
A. |
fail to form heads |
|
B. |
fail to gastrulate |
|
C. |
fail to induce neural tissue |
|
D. |
form giant heads |
Dickkopf genes in mouse have been found to be involved in the embryonic head induction and limb morphogenesis. As provided in the question, we have identified a recessive mutation in the mouse where the expression of this gen has been strongly disrupted. therefore the individuals homozygous for this mutation would not be able to produce the required levels of the protein and it will definitely produce embryos lacking head structures. hence option A appears most appropriate.
Rest of the options donot have any chance as it has liitle no effect on gastrulation, or induction of neural tissue. the formation of gaint heads is not possible at all.
Thank u
Scientists have created a DKK1 knockout model in mice that revealed the effects of this gene. All mice that were homozygous for the DKK1 knockout were dead at birth due to defects in the cranium and structures formed by the neural crest, such as failed development of eyes, olfactory placodes, frontonasal mass and mandibular processes, as well as incomplete development of the forebrain and midbrain and fusion of the digits of the forelimb.[7] This evidence supports the idea that inhibition of the Wnt signaling pathway by DKK1 is crucial to proper cranial development.
You have identified a recessive mutation in the mouse, in which expression of the mouse dickkopf...
Due to a recessive mutation in gene A, amino acid ‘Glu’ in position 25 of polypeptide A (the wild polypeptide) is replaced by ‘Ala’. Individuals who are homozygous for the mutant allele (aa) don’t have any phenotypic alterations. Based on this observation, which of the following IS TRUE? A. The mutation has occurred in the promoter. B. The mutation has occurred in one of the introns of the encoding gene. C. The mutation was a base substitution in one of...
Researchers have identified a gene in humans that (when mutant) causes severe dwarfism and mental retardation. This disorder is inherited in an autosomal recessive manner, and the mutant allele is known to be a loss-of-function mutation. The same gene has been found on mice, although a mutant version of the gene has not been discovered in mice. To develop drugs and an effective therapy to treat this disorder, it would be extremely useful to have a mouse model of the...
Given that TP53 is a recessive gene and is not located on the X chromosome, why would people who inherit just one mutant copy of a recessive tumor-suppressor gene be at higher risk of developing cancer than those without the recessive gene? Given that is a recessive gene and is not located on the X chromosome, why would people who inherit just one mutant copy of a recessive tumor-suppressor gene be at higher risk of developing cancer than those without...
FIVE. You have identified a new mutant in Drosophila that defines a gene you call “red.” When mutant it causes the “neck” of the fly (cervical connective) to be red. It behaves as an autosomal recessive mutation with alleles red+ and red-. You suspect it is linked to two known genes on the second chromosome “re” and “ti”. The re- mutation behaves as an autosomal recessive. Homozygous mutant flies fixate on TV reruns, “re+” normal flies avoid TV. The “ti”...
Clicker question Pancreas Lens and cornea Neural tube Retina AUG Enhancers: A B D Exons: 0 12 3 4 5 5 6 7 loxP DEVELOPMENTAL BIOLOGY, Seventh Edition Figure 5.7 S e i ne Liver Promoter cre If a mouse line is generated that is homozygous for the floxed pax6 allele (top) and contains the transgene shown on the bottom, in which tissue(s) will pax6 be disrupted? A. Neural tube and lens B. Retina C. Pancreas D. Liver Clicker question:...
You are interested in mouse eye development and conduct a genetic screen for mutations that result in strong eye defects. After treating a male mouse with ENU (a chemical mutagen that induces base-pair changes and small deletions), you identify four mouse mutants 1-4, each with defective eyes. You cross each of the four mutant mice with eye defects to homozygous wild type mice and examine the progeny from each cross. What type of information can you get from observing the...
Different genes have been identified as causative for inherited forms of deafness. Because inherited deafness is a relatively rare characteristic in the population, individuals who are homozygous recessive for one gene that causes deafness are typically homozygous for functional alleles at other loci controlling the hearing phenotype. Knowing this, suppose a deaf man is homozygous for a recessive deafness allele on chromosome 17. He marries a deaf woman who is homozygous for a different recessive deafness allele on chromosome 3....
A new mutation has been discovered that causes cancer. You have identified the gene sequence where the mutation occurs. Below is the sequence from your mother who is normal and you who have this mutation in your DNA. Mother: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUCAACCUAUCCCUAAGGGUAAAAA 3' You: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUGAACCUAUCCCUAAGGGUAAAAA 3' What type of mutation is shown in your DNA sequence? 01) Nonsense 2) Deletion 3) Missense 4) Frame shift
Which of the following is an example of epistasis? Select one: a. Homozygous recessive Drosophila females for gene w have white eyes. When crossed to red eye males, all the females have red eyes and all the males have white eyes. b. A man with blood type A marries a woman who is type B. Their firstborn's blood type is 0 C. Smurfberry bushes that are Homozygous dominant for gene S produce tall plants. Homozygous recessive plants show a dwarf...
70. RNA synthesis in bacteria requires which of the following? a. DNA polymerase III b. A primer c. A DNA template d. DNA Gyrase e. Deoxyribonucleotide triphosphate 86. Two phenotypically normal people have 4 children. 3 are phenotypically normal like their parents, but one is an albino. What are the probable genotypes of the parents? a. Both parents are homozygous dominant b. Both parents are homozygous recessive c. One parent is homozygous dominant and the other is homozygous recessive d....