What portion of the TCR is in the carboxy tail and amino ends of the Alpha...
- What portion of the TCR is in the carboxy tail and amino ends of the Alpha Beta peptides? (Variable region or intracellular end?)
Homework Answers
- TCR ( T cell receptor) is the receptor molecule expressed on the surface of T cells which binds to antigenic peptides.
- TCR is itself composed of two chains : alpha and beta, bound together by a disulfide linkage.
- Each chain has constant and variable regions. The variable region of TCR is composed of CDRs or complementarity determining regions, which bind to antigenic peptides.
- The CDR of alpha chain of TCR binds to N terminal (amino end) of peptide, whereas CDR of beta chain binds to C terminal (carboxy tail) of peptide.
Hence, the portion of TCR in the carboxy tail and amino ends of the alpha beta peptides is Variable region.
Add Answer to:
What portion of the TCR is in the carboxy tail and amino ends
of the Alpha...
CAN SOMEONE VERIFY QUESTION 1 AND EXPLAIN QUESTION 2. WHAT ARE THE CARBOXY AND AMINO (N)...
CAN SOMEONE VERIFY QUESTION 1 AND EXPLAIN QUESTION 2. WHAT ARE THE CARBOXY AND AMINO (N) ENDS AND HOW DO I RECOGNIZE THEM? WILL LEAVE RATE AND COMMENT! The following is an mRNA transcribed from a prokaryotic gene. 5’-UCAUAAGGAUGCCACCAACCGGCGGAUCAGGCCCGUGACACCUUGG-3’ 1. Write the corresponding double-stranded DNA sequence the mRNA is transcribed from. Indicate the 5’ and 3’ ends of both strands and indicate the coding and template strands. 3’-AGTATTCCTACGGTGGTTGGCCGCCTAGTCCGGGCACTGTGGAACC-5’ 2. Write the amino acid sequence of the encoded polypeptide. Indicate the...
1. Draw the dipeptide His-Gly at pH 7.4. 2. Label the amino terminus, the carboxy terminus,...
1. Draw the dipeptide His-Gly at pH 7.4. 2. Label the amino terminus, the carboxy terminus, the two alpha carbons, and the peptide bond (1pt). 3. Calculate it’s net charge. 4. What is the net charge of this dipeptide at pH = 2? 5. List the levels of protein structure and the types of bonds/interactions that are characteristic of each level.
Lecture 3 Identify amino-/carboxy termini, and R-group on amino acid What is chirality? Identify a carbon...
Lecture 3 Identify amino-/carboxy termini, and R-group on amino acid What is chirality? Identify a carbon that is chiral (i.e., has 4 different groups attached) Chiral compounds rotate plane polarized light Memorize amino acid 1) structure, 2) classification (hydrophobic, aliphatic, aromatic, negatively charged, positively charged, polar uncharged) Be able to draw glycine (the generic amino acid) Given an amino acid structure and pKas of ionizable groups, be able to determine the charge at pH 1, pH 14, and pH 7...
which amino acids restrict alpha helical or beta pleated sheets formation, what are the properties that...
which amino acids restrict alpha helical or beta pleated sheets formation, what are the properties that they have that make them do so.
The following is a portion of the amino acid sequence of human GLUT1 purified from red...
The following is a portion of the amino acid sequence of human GLUT1 purified from red blood cells. Glucose is also shown for your convenience. 147 151 161 171 181 vspt alrgalgtlh qlgivvqili aqvfgldsim gnkd A. An internal 23 amino acid region of the sequence above is the 5th transmembrane domain of GLUT1. The beginning of the sequence is an intracellular loop. The end of the sequence is an extracellular loop. Indicate where these regions might be in the sequence. Explain how you derived at your hypothesis....
a piece of eukaryotic DNA is shown below: 5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA...
a piece of eukaryotic DNA is shown below: 5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA PRODCUED, IF THIS IS THE CODING STRAND? b)Assuming that after processing, a cap is added to the mRNA at the 5’ end, predict the amino-acid sequence of the protein produced from this piece of mRNA using SINGLE LETTER codes. In your answer denote both the amino and carboxy ends of the protein? THANKS FOR THE HELP.
2. what is the configuration of almost all naturally occurring amino acids at the a (alpha)...
2. what is the configuration of almost all naturally occurring amino acids at the a (alpha) carbon 3. why is an alpha amino acid such as alanine more acidic than a regular carboxyllic acid 4. strecker synthesis Formation dl-phenylalanine 5. outline the steps to synthesize the simple dipeptide AL (think about two amino acids that begin with an A and an L) 6. give the structure and name of the nucleosides in dna and rna 7. give the structure of...
Question 10 (4 points) Although all protein structures are unique, there are common structural building blocks...
Question 10 (4 points) Although all protein structures are unique, there are common structural building blocks that are referred to as regular secondary structures, Some proteins have alpha-helices, some have beta-sheets, and still others have a combination of both. What makes it possible for proteins to have these common structural elements? 12 15 a) the hydrophobic-core interactions. b) hydrogen bonds that form along (alpha helices) or between (beta sheets) polypeptide backbones. c) side-chain interactions d) specific amino acid sequences. 7...
Select all that apply. What amino acids are synthesized from alpha - ketoglutarate? histidine valine glutamate...
Select all that apply. What amino acids are synthesized from alpha - ketoglutarate? histidine valine glutamate methionine proline arginine isoleucine alanine lysine glutamine phenylalanine leucine
QUESTION 13 What chemical group is at the end of an amino acid chain corresponding to...
QUESTION 13 What chemical group is at the end of an amino acid chain corresponding to the 3' end of the mRNA molecule? A. Peptide bond B.5 phosphate group C.3" hydroxyl group D. Amino (N-terminus) E. Carboxyl (C-terminus) QUESTION 14 Which of the following is true regarding pre-mRNA modifications/processing? O A. Alternative splicing allows for increased complexity and synthesis of protein isomers OB. The 5' cap is added after RNA polymerase dissociates from the gene OC. The poly A tail...
Lecture 3 Identify amino-/carboxy termini, and R-group on amino acid What is chirality? Identify a carbon that is chiral (i.e., has 4 different groups attached) Chiral compounds rotate plane polarized light Memorize amino acid 1) structure, 2) classification (hydrophobic, aliphatic, aromatic, negatively charged, positively charged, polar uncharged) Be able to draw glycine (the generic amino acid) Given an amino acid structure and pKas of ionizable groups, be able to determine the charge at pH 1, pH 14, and pH 7...
2. what is the configuration of almost all naturally occurring amino acids at the a (alpha) carbon 3. why is an alpha amino acid such as alanine more acidic than a regular carboxyllic acid 4. strecker synthesis Formation dl-phenylalanine 5. outline the steps to synthesize the simple dipeptide AL (think about two amino acids that begin with an A and an L) 6. give the structure and name of the nucleosides in dna and rna 7. give the structure of...
Question 10 (4 points) Although all protein structures are unique, there are common structural building blocks that are referred to as regular secondary structures, Some proteins have alpha-helices, some have beta-sheets, and still others have a combination of both. What makes it possible for proteins to have these common structural elements? 12 15 a) the hydrophobic-core interactions. b) hydrogen bonds that form along (alpha helices) or between (beta sheets) polypeptide backbones. c) side-chain interactions d) specific amino acid sequences. 7...
Select all that apply. What amino acids are synthesized from alpha - ketoglutarate? histidine valine glutamate methionine proline arginine isoleucine alanine lysine glutamine phenylalanine leucine
QUESTION 13 What chemical group is at the end of an amino acid chain corresponding to the 3' end of the mRNA molecule? A. Peptide bond B.5 phosphate group C.3" hydroxyl group D. Amino (N-terminus) E. Carboxyl (C-terminus) QUESTION 14 Which of the following is true regarding pre-mRNA modifications/processing? O A. Alternative splicing allows for increased complexity and synthesis of protein isomers OB. The 5' cap is added after RNA polymerase dissociates from the gene OC. The poly A tail...
Most questions answered within 3 hours.
-
. A marketing researcher conducted a survey of 25 shoppers
randomly selected at the local mall...
asked 13 minutes ago -
Create an comprehensive response to the
following:
Antimicrobial agents work on a multitude of microbes (bacteria,...
asked 15 minutes ago -
6.13 LAB: Step counter. Section 6.3.
A pedometer treats walking 2,000 steps as walking 1 mile....
asked 10 minutes ago -
(14.2) A block of mass m = 10 kg riding on a frictionless
horizontal plane is...
asked 14 minutes ago -
Use any search engine to search for articles about Starbucks
partnership with Tata Companies in India...
asked 12 minutes ago -
Let’s say that for some reason Bank Excess Reserves suddenly
increase sharply. What effect would this...
asked 21 minutes ago -
Given:
Curent Assets: $600,000
Total Assets: $2,600,000
Current Liabilities: $500,000
Total Liabilities: $1,700,000
What is the...
asked 27 minutes ago -
1. What is a “Bankster”? What is insider trading? Why is it
illegal?
2. What is...
asked 25 minutes ago -
A transverse wave on a cord is given by
D(x,t)=0.18sin(2.7x−61.0t), where Dand x are in m...
asked 31 minutes ago -
ASSIGNMENT
ANSWER ANY TWO OF THE FOLLOWING IN 2-3 PARAGRAPHS OF EACH
QUESTION.
1: Where is...
asked 30 minutes ago -
Question 1 (5 marks)
Studies have shown that the price elasticity for GP
consultations is -0.2...
asked 32 minutes ago -
The owner of 22 restaurants was asked how he does marketing
research. He answered that he...
asked 36 minutes ago