CAN SOMEONE VERIFY QUESTION 1 AND EXPLAIN QUESTION 2. WHAT ARE THE CARBOXY AND AMINO (N)...
CAN SOMEONE VERIFY QUESTION 1 AND EXPLAIN QUESTION 2. WHAT ARE THE CARBOXY AND AMINO (N) ENDS AND HOW DO I RECOGNIZE THEM? WILL LEAVE RATE AND COMMENT!
The following is an mRNA transcribed from a prokaryotic gene.
5’-UCAUAAGGAUGCCACCAACCGGCGGAUCAGGCCCGUGACACCUUGG-3’
1. Write the corresponding double-stranded DNA sequence the mRNA is transcribed from. Indicate the 5’ and 3’ ends of both strands and indicate the coding and template strands.
3’-AGTATTCCTACGGTGGTTGGCCGCCTAGTCCGGGCACTGTGGAACC-5’
2. Write the amino acid sequence of the encoded polypeptide. Indicate the amino (N) and carboxy (C) ends of the polypeptide.
Homework Answers
Q1. Ans :
This is the DNA double stranded sequence, from the mRNA given in question transcribed from : -
5'-TCATAAGGATGCCACCAACCGGCGGATCAGGCCCGTGACACCTTGG-3' - Coding Strand
3'-AGTATTCCTACGGTGGTTGGCCGCCTAGTCCGGGCACTGTGGAACC-5’ - Templete Strand
Q2. Ans:
5’-UCAUAAGGAUGCCACCAACCGGCGGAUCAGGCCCGUGACACCUUGG-3’
The Amino Acid sequence of the encoded polypeptide are followings
:-
N-terminal (Amino) end Met-Pro-Pro-Thr-Gly-Gly-Ser-Gly-Pro C-terminal (Carboxy) end.
AUG : Start Codon
UGA : Stop Codon
Add Answer to:
CAN SOMEONE VERIFY QUESTION 1 AND EXPLAIN QUESTION 2.
WHAT ARE THE CARBOXY AND AMINO (N)...
1.) In which direction is RNA transcribed? 2.) Which of the two strands (A or...
1.) In which direction is RNA transcribed?
2.) Which of the two strands (A or B) serves as the TEMPLATE
strand for the transcription of a mRNA that contains both a start
and a stop codon?
3.) Which number (1, 2, 3, 4, or 5) best approximates the
location of the -10 consensus sequence?
4.) How many amino acids long is the protein encoded by the mRNA
from this DNA sequence?
5.) What is the second...
Can someone outline how I would go from my DNA sequence to my final product of...
Can someone outline how I would go from my DNA sequence to my
final product of coding the amino acids. I am confused on the
complimenting strands and which ones I would need.
Below is the coding sequence of very small prokaryotic gene. The coding sequence is shown in red while the regulatory sequences are shown in black and the UTR in blue. The underlined sequences denote the -10 sequence. The arrow marks the point of a 5 base insertion...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given...
Please solve each item in a detailed and descriptive way.
Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
You are given the following sequence of DNA which encodes for a short protein (this is...
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding and sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 3: 5'ACTGCCCATGGTGGTACCT GAC TCC TGAGGAG 3' On the line above, write the sequence for the template DNA strand. On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the...
1.) In which direction is RNA transcribed?
2.) Which of the two strands (A or B) serves as the TEMPLATE
strand for the transcription of a mRNA that contains both a start
and a stop codon?
3.) Which number (1, 2, 3, 4, or 5) best approximates the
location of the -10 consensus sequence?
4.) How many amino acids long is the protein encoded by the mRNA
from this DNA sequence?
5.) What is the second...
Can someone outline how I would go from my DNA sequence to my
final product of coding the amino acids. I am confused on the
complimenting strands and which ones I would need.
Below is the coding sequence of very small prokaryotic gene. The coding sequence is shown in red while the regulatory sequences are shown in black and the UTR in blue. The underlined sequences denote the -10 sequence. The arrow marks the point of a 5 base insertion...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
Please solve each item in a detailed and descriptive way.
Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding and sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 3: 5'ACTGCCCATGGTGGTACCT GAC TCC TGAGGAG 3' On the line above, write the sequence for the template DNA strand. On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the...
Most questions answered within 3 hours.
-
Asked if he has any regrets about the way he's handled the
coronavirus crisis so far,...
asked 2 minutes ago -
True or False?
Considering a door as a rigid body. Its angular motion happens
in a...
asked 5 minutes ago -
In
IUPAC naming, do we concider the prefix in alphabatizing?
In other words do we look...
asked 11 minutes ago -
If a trust has income required to be distributed of $11,500,
other amounts paid or required...
asked 27 minutes ago -
The degree of ionization of a weak acid
____________________.
Select all that are True.
a) varies...
asked 27 minutes ago -
Cereal for Breakfast. A cereal company claims
70% of Americans start the day with cereal for...
asked 27 minutes ago -
An elevator has a placard stating that the maximum capacity is
2400 lblong dash15 passengers. So,...
asked 30 minutes ago -
two charged proteins P1 and P2 are located at the positions
(1m,1m) and (-1m,1m) respectively on...
asked 41 minutes ago -
eBook
Calculator
Job Order Cost Sheet
Remnant Carpet Company sells and installs commercial carpeting
for office...
asked 46 minutes ago -
Using Kapustinskii equation, determine the lattice energy of a
hypothetical compound NaCl2 . Assume the sum...
asked 48 minutes ago -
Most schools and
businesses require some standard style of documentation for written
reports. Discuss why might...
asked 45 minutes ago -
cookbooks are going metric. in such books 1 cup is equal to 240
ml. Express 1...
asked 48 minutes ago