Question

Below is the coding sequence of very small prokaryotic gene. The coding sequence is shown in red while the regulatory sequences are shown in black and the UTR in blue. The underlined sequences denote the -10 sequence. The arrow marks the point of a 5 base insertion (TTATA). AATATAATCAGGAATACATCAGCTAAGATGACCATGATTACGGATTCCATAAACGT-3' VAC AUG A. Is there a change in the reading frame as a result of the insert? -since it is inserted in the reading frame "especially disrupts the start codon B. If the mRNA were transcribed, could this insertion affect the translation of the mRNA? Yes - disrupts stan codon injection Coding sequence ATT TATAGA CCA TGA TTA CGG ATT CCA TAA MIRNA : UN That's

Can someone outline how I would go from my DNA sequence to my final product of coding the amino acids. I am confused on the complimenting strands and which ones I would need.

Answer 1

the coding strand is the DNA strand whose base sequence corresponds to the base sequence of the mRNA transcript produced.

Template strand is the DNA strand complentary to mRNA transcript.

For example, ( i will be using your coding squence in red ) for the given sequence

5' ATGACCATGATTACGGATTCCATAA 3' given coding DNA strand ( this strand is not used for transcription )

3' TACTGGTACTAATGCCTAAGGTATT 5' is the DNA template strand (complementary to coding strand and this strand is used during transcription).

# During transcription RNA polymerase scans the template strand and codes the complementary mRNA.

*The transcribed mRNA sequence is

5' AUGACCAUGAUUACGGAUUCCAUAA 3' this is same sequence as coding strand DNA, except there is U instead of T. Hence the term coding strand.

# During translation, this mRNA sequence is grouped into triplets. 5'  AUG ACC AUG AUU ACG GAU UCC AUA A 3'

This triplet codon codes for their corresponding amino acids as per genetic code and forms protein. For example AUG codes for methionine.

I hope u understand it.