For part 1 of this lab) I collected a soil sample from my campus Part 2) Tested bacteria initial viability Part 3) DNA extraction Part 4) DNA quantification by Nanodrop Part 5) Sample sequencing Part 6) PCR amplification Part 7) Gel electrophoresis Part 8) DNA sequence data analysis (sent sample to another lab)
1) What type of conclusions can be made from initially culturing on nutrient agar (e.g., qualitative assessment, quantitative assessment, preliminary, estimate, descriptive, or bacterial diversity)?
2) What can be a hypothesis for this experiment?
3) What are the controls for this experiment? What are key environmental data to collect that cannot be controlled between samples?
Answer 1:)
The initial culturing on the plate gives quantitative assessment as it is performed for the viability. Data sequence analysis is a qualitative assessment as it gives information about the type of bacteria grown in the soil sample.
Answer 2:)
The design of the experiment is suggesting that it is performed for the isolation of bacteria and its identification. Therefore, the hypothesis would be as the following statement.
“Soil in the campus may contain an unrecognized bacterium species”.
Answer 3:)
The negative control should be double distilled water, as it will show no bacterial growth in the agar plates. The positive control can be a culture of a predefined bacterium species.
The temperature and humidity are the key environmental factors that cannot be controlled.
For part 1 of this lab) I collected a soil sample from my campus Part 2)...
For part 1 of this lab) I collected a soil sample from my campus Part 2) Tested bacteria initial viability Part 3) DNA extraction Part 4) DNA quantification by Nanodrop Part 5) Sample sequencing Part 6) PCR amplification Part 7) Gel electrophoresis Part 8) DNA sequence data analysis (sent sample to another lab) Directions for Part 3 DNA extraction are in the attached image QUESTIONS REGARDING PART 3 (DNA extraction) 1) What type of conclusions can be made from initially...
En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard the supernatant, but keep the pellet. In step 15, you discard the pellet, but keep the supernatant. Explain why the pattern is different between the two steps and the consequence of mixing up these two steps. Procedure Part 1: mt DNA Isolation from your cheek cells. Lysis solution is used to breakdown the cells in this step, you will isolate MEONA from cheek cells....
1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It is 249 bp long, and is suspected to be a serine protease inhibitor ATGAGCAGCGGCGGCCTGCTGCTGCTGCTGGGCCTGCTGACCTTTTGCGCGGAACTGACC CCGGTGAGCAGCCGCAAACGCCATCCGTATTGCAACCTGCCGCCGGATCCGGGCCCGTGC CATGATAACAAATTTGCGTTTTATCATCATCCGGCGAGCAACAAATGCAAAGAATTTGTG TATGGCGGCTGCGGCGGCAACGATAACCGCTTTAAAACCCGCAACAAATGCCAGTGCACC TGCAGCGGC a) Which sequencing method would you use to sequence a gene in this size range, and why? (Name of technique and 1-2 sentence explanation.) b) What technique would you use to amplify the DNA, in order to make more of it for future experiments? (What is...
I need the answers for questions 2 and 3. My DNA ladder is in lane 2 marked by the yellow arrow. Thanks! Here is the only other info I have. Thanks! Part 2: Gel purification and on Gel Slice and PCR Product Preparin modified from TBSci.com instructions for gaan A. Dissolving the Gel Stie Following electrophores, eral DNA band from grand place glice microcentrifuge tube Ib. Use an analytical balance to weigh pelice Rec die 2. Add 500 balance to...
I just need the answers to questions 2 and 3. My DNA ladder is in lane 2 with the yellow arrow pointing to it. Thanks! Part 2: Gel purification and ration Gel Slice and PCR Product Preparation modified from IBSci.com instructions for gel and PCR clean-up system A. Dissolving the Gel Slice 1. Following electrophoresis, excise DNA band from gel and place gel slice in a 1.5ml microcentrifuge tube. 1b. Use an analytical balance to weigh gel slice. Record weight...
LAB Genetic Engineering of Bacteria Problem Is it possible to transfer the allele for resistance to the antibiotic ampicillin into a bacterial cell? Objectives After completing this lab, the student will be able to: 1. Demonstrate micropipetting and sterile pipetting techniques for handling and transferring bacteria and plasmid DNA. 2. Maintain sterile conditions for culturing bacterial cells. 3. Inoculate bacteria into flasks, culture tubes, or agar plates. 4. Culture isolated individual colonies from an agar plate to form genetically identical...
1. Describe the functions of the following reagents in extraction of DNA from corn meal: proteinase K; guanidine HCI; SDS 2. Why is the ratio of the OD at 260 and 280 nm used to estimate DNA purity? 3. In one paragraph, summarize basic principles of PCR technique in your own words. List all the reagents you will need to perform a PCR experiment. Does this method tell you what genetic modifications were made? If yes, describe how you can...
LAB17 Genetic Engineering of Bacteria Problem Is it possible to transfer the allele for resistance to the antibiotic ampicillin into a bacterial cell? Objectives After completing this lab, the student will be able to: 1. Demonstrate micropipetting and sterile pipetting techniques for handling and transferring bacteria and plasmid DNA. 2. Maintain sterile conditions for culturing bacterial cells. 3. Inoculate bacteria into flasks, culture tubes, or agar plates. 4. Culture isolated individual colonies from an agar plate to form genetically identical...